Labshake search
Citations for Lonza :
201 - 250 of 1957 citations for 4 Methoxy 2 2 3 4 5 5 Hexacb Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)– 2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... 1% penicillin-streptomycin (penicillin 50 U/ml and streptomycin 50 μg/ml, final concentration; Lonza) at 37 °C with 5% CO2 ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM glutamine (Lonza) and 100 U/mL penicillin/streptomycin (Lonza) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM glutamine (Lonza) and 100 U/mL penicillin and streptomycin (Lonza) ...
-
bioRxiv - Bioengineering 2021Quote: ... EGM-2 medium (Lonza) was added in a 1:1 ratio to the cell suspension before a centrifugation step at 300g for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM glutamine (Lonza) and 50 ng/mL RANKL (Peprotech) ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... in EGM-2 (Lonza) for 24 hrs prior to plating ...
-
bioRxiv - Immunology 2022Quote: ... 2 mM glutamine (Lonza), 50 U/mL penicillin ...
-
bioRxiv - Immunology 2022Quote: ... 2 mM glutamine (Lonza), 50 U/mL penicillin ...
-
bioRxiv - Immunology 2022Quote: ... 2 mM HEPES (Lonza), 100 µg/ml collagenase from Clostridium histolyticum type IV (Sigma-Aldrich ...
-
bioRxiv - Pathology 2021Quote: ... 2 mM glutamine (Lonza), and 100 U/ml Penicillin-Streptomycin (PS ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM UltraGlutamine (Lonza) and 1% Penicillin-Streptomycin (Biowest) ...
-
bioRxiv - Cell Biology 2021Quote: ... EGM-2 medium (Lonza) supplemented with 16% defined foetal bovine serum (FBS ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... to FGM-2 (Lonza), made per manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM UltraGlutamine (Lonza), 100 units/ml penicillin and 100 µg/ml streptomycin (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... in EGM-2 (Lonza) culture medium kit ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM glutamine (Lonza) and P/S/A (Lonza) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM glutamine (Lonza) and P/S/A (Lonza) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM glutamine (Lonza), 20 µg/mL pituitary extract (Gibco) ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM UltraGlutamine (Lonza), 100 units/mL penicillin ...
-
bioRxiv - Cancer Biology 2022Quote: ... the culture medium was replaced with 2 mL of DMEM-F12 (LONZA #12-719F) supplemented with 10 % FBS ...
-
bioRxiv - Molecular Biology 2019Quote: ... and ECs from healthy donor and patients were cultured in EGM-2 (EBM-2 + SingleQuots™ Kit) and 2% Foetal Bovine Serum (FBS) (Lonza). HUVECs and ECs were used between P2 and P6 passage ...
-
bioRxiv - Microbiology 2021Quote: ... HPMEC were cultured in endothelial cell growth basal medium 2 supplemented with an Endothelial Cell Growth Medium-2 (EGM-2™) supplemental bullet kit (Lonza). Cells were maintained at 37°C with 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... supplemented with Ultraglutamine-1 (4 mM; Lonza) and antibiotic-antimycotic (1% ...
-
bioRxiv - Cancer Biology 2019Quote: ... were transfected using 4-D electroporator (LONZA), following manufacturer instruction ...
-
bioRxiv - Immunology 2022Quote: ... and 4 mM of L-glutamine (Lonza). HLA-E expressing K562 cells were sorted and maintained in complete RPMI supplemented with 2 µg/mL blasticidin (Sigma-Aldrich ...
-
bioRxiv - Physiology 2019Quote: HPASMCs were cultured in Smooth Muscle Growth Medium-2 (SmGM™-2, Lonza). The proliferation of HPASMCs was evaluated using both the Cell Counting Kit-8 (CCK-8 ...
-
bioRxiv - Cell Biology 2020Quote: ... were purchased from Lonza and grown in EMB-2 media supplemented with EGM-2 SingleQuot Kits (Lonza). Cells were transfected with miR-1253 Pre-miR miRNA Precursor (Assay ID #PM13220 ...
-
bioRxiv - Bioengineering 2021Quote: ... HUVECs were cultured in endothelial cell growth basal medium-2 (EBM-2; Lonza) supplemented with FBS and an EGM-2 BulletKit (Lonza ...
-
bioRxiv - Genetics 2022Quote: ... supplemented with Smooth Muscle Medium-2 SingleQuots Kit (SmGM-2, CC-4149, Lonza) (complete media) ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were expanded in EGM-2 MV media (EBM-2 supplemented with Lonza’s SingleQuot supplements ...
-
bioRxiv - Bioengineering 2022Quote: ... were obtained from Thermo Fisher Scientific and cultured with EGM-2 medium (EGM™-2 BulletKit™, Lonza). Once reached 80-90% confluency ...
-
bioRxiv - Bioengineering 2023Quote: ... containing Microvascular Endothelial Cell Growth Medium-2 SingleQuots Kit (EGM-2 MV, Lonza). Both cell lines proliferate at the permissive temperature of 33°C and maturate at 37°C.
-
bioRxiv - Immunology 2023Quote: ... were cultured in endothelial cell basal medium-2 (EBM-2: Lonza, Basel, Switzerland) supplemented with the EGM-2 MV SingleQuots kit (Lonza) ...
-
bioRxiv - Bioengineering 2023Quote: ... were cultured on dishes in Endothelial Cell Growth Medium-2 (EGM-2; Lonza). Normal human dermal fibroblasts (NHDFs ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were expanded in EGM-2 MV media (EBM-2 supplemented with Lonza’s SingleQuot supplements ...
-
bioRxiv - Molecular Biology 2024Quote: ... and resuspended in EBM™-2 (Endothelial Cell Growth Basal Medium-2, Lonza). 500 μl EGM-2 BulletKit™ culture medium (with full supplements ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were expanded in EGM-2 MV media (EBM-2 supplemented with Lonza’s SingleQuot supplements ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.
-
bioRxiv - Bioengineering 2022Quote: ... 5 × 107 hepatocytes were suspended in 30 mL of HCM™ (Lonza, Sales Ltd, Basel, Switzerland) and injected via the bile duct at a flow rate of 1 mL/min ...
-
bioRxiv - Bioengineering 2022Quote: ... 20 μL of T cells were resuspended in P3 buffer at 5 × 107 cells/mL (Lonza) and added to the electroporation mixture ...
-
bioRxiv - Molecular Biology 2019Quote: ... and cultured in endothelial cell basal medium-2 (EBM-2) supplied with EGM™-2 BulletKit™ (catalogue no. CC-5035; Lonza). HEK293A cells were purchased from Invitrogen (catalog no ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and the cell pellet was resuspended in Keratinocyte Growth Medium-2 Bullet Kit (KGM2 medium) consisting of KGM-2 Basal Medium and KGM-2 SingleQuots Supplements (Lonza, Basel, Switzerland), and then seeded onto Petri dishes coated with collagen IV ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 5% decomplemented FBS (Lonza), 1 M HEPES (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with horse serum (5%, Lonza), recombinant human insulin (5 ug/mL) ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: ... and 50 mg/ml streptomycin(Lonza), supplemented with SMAD inhibitors (DMH-1 2 µM ...
-
bioRxiv - Cell Biology 2019Quote: ... and 50 μg/ml Gentamycin (Lonza). Upon selection ...
-
bioRxiv - Cell Biology 2019Quote: ... and 50 μg/ml Gentamycin (Lonza); mES cells were cultured either on a monolayer of gamma irradiated mouse embryonic fibroblasts (IRR-MEFs ...