Labshake search
Citations for Lonza :
301 - 350 of 4401 citations for Dengue Virus Serotype 1 Envelope Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: 5 × 105 THP-1 cells were resuspended in 20µL nucleofection solution (16.4µL SG nucleofector solution + 3.6µL supplement 1) from the SG Cell Line 4D-Nucleofector™ X kit (Lonza, V4XC-3032). 300pmol PPP2R1A sgRNA (Synthego ...
-
bioRxiv - Cancer Biology 2019Quote: 1-4 × 106 dissociated cells were re-suspended in 100 µL of Amaxa Mouse NSC Nucleofector Solution (VPG-1004, Lonza) with 5 µg of plasmid DNA ...
-
bioRxiv - Microbiology 2021Quote: 2×106 Elijah cells were washed in PBS and resuspended in 20 μl P3 Primary Cell Nucleofector Solution buffer prepared with Supplement 1 buffer (Lonza) according to the manufacturer’s instructions (P3 Primary Cell 4D-Nucleofector X Kit S) ...
-
bioRxiv - Systems Biology 2020Quote: ... 24 hours activated DC and T cells were incubated in 96 well plates at a DC/T ratio 1:5 in Xvivo15 medium (Lonza). After 6 days ...
-
bioRxiv - Microbiology 2020Quote: ... The same number of cells (2 x 106 cells) were lysed in 100 µl of 1% CHAPS/PBS and analyzed on 4-20% SDS-PAGE gel (Lonza). The envelope proteins were detected by 2F5 (specific for gp41 ...
-
bioRxiv - Immunology 2021Quote: ... MICB or ULBP-1 genes after optimizing nucleofection conditions using primary cell 4D nucleofector kit and 4D nucleofector system (Lonza). After 48 hours of culture ...
-
bioRxiv - Neuroscience 2021Quote: ... dissociated with Accutase and then transfected with one of the Tau or Tubulin pUCM vectors along with AAVS1 TALEN pairs using a Human Stem Cell Nucleofector Kit 1 (Lonza) with the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... 1*106 purified naïve T-cells were resuspended in 15 μL buffer P3 + 5 μL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7 μL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... The guide RNA vector was then electroporated into the parent line containing the CRISPRi system using the Human Stem Cell Nucleofector Kit 1 solution with the Amaxa nucleofector 2b device (Lonza). Nucleofected cells were then seeded into a 6-well plate in mTeSR™-1 supplemented with Y-27632 (10 μM ...
-
bioRxiv - Immunology 2020Quote: 2×106 freshly isolated primary B cells were washed in PBS and resuspended in 20 μl P3 Primary Cell Nucleofector Solution buffer prepared with Supplement 1 buffer (Lonza) according to the manufacturer’s instructions (P3 Primary Cell 4D-Nucleofector X Kit S) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lung cancer cell lines (H3122, H2228, A549, H460, Calu-1, and H1437) were cultured in RPMI-1640 (Lonza, 15-1675) supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... Stable LBH-overexpressing BT549 cell lines were generated by nucleofection of 2×106 BT549 cells with 2 μg linearized pCDNA3 or pCDNA3+Lbh 13 and 1 μg pEGFP (Lonza) in Solution V (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... The enriched CD4+CD25hi cells were cultured in 24-well non-tissue culture plates at 1 x 106 cells/mL in X-Vivo-15 (Lonza) supplemented with 10% heat-inactivated human AB serum (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: African green monkey kidney epithelial BSC-1 cells (ATCC CCL-26) were maintained in Eagle’s minimal essential medium (EMEM; Lonza, Inc.) containing 5% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... This plasmid was nucleofected into the NGN2 iPS line (obtained as described above) using a nucleofection kit (Human Stem Cell Nucleofector Kit 1, VPH-5012, Lonza) containing 4 μg of RFP PB construct and 1 μg of dual helper plasmid ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were nucleofected with 1 nmol ASO against MERVL or Scramble ASO using P3 Primary Cell 96-well Nucleofector Kit (Lonza) according to manufacturer’s instruction and seeded into each well of a 24-well plate containing 500 µl of ESC medium with 2i ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were plated at 1 × 104/well in black 96-well plates using Bio Whittaker HBSS (BE10-527F, Lonza, Switzerland) with 4.5 g/L glucose ...
-
bioRxiv - Cancer Biology 2022Quote: ... and resuspended in a mixture of 16.4 µl SF cell line solution and 3.6 µl supplemental solution-1 (Lonza, V4XC-2032). The sgRNA and Cas9 ribonuclease protein complex under incubation was then mixed with the cell suspension and 20 µl of it was put a cuvette and nucleofected using 4D-Nucleofector (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: Cell and organoid lines were generated from C3-TAg tumors (supplementary file 1) and tested for mycoplasma (Lonza, LT07-703) prior to use and the creation of frozen stocks ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... were delivered as a ribonucleoprotein complex with the DNA donor template using a Nucleofector 2b Device and the Human Stem Cell Nucleofector Kit 1 (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1×105 cells were grown in each well of 12 well culture plates in SkGM-2 BulletKit growth medium (Lonza) to >90% confluency under standard culture conditions of 37°C and 5% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... and the ssODN (1 μl; stock 100 μM, IDT) in 20 μl of nucleofection buffer P3 (P3 Primary Cell NucleofectorTM Solution, Lonza) were nucleofected (program CA137 ...
-
bioRxiv - Molecular Biology 2023Quote: ... MRTF-WT and MRTF knockout in NIH 3T3 (MRTF-KO-1 and MRTF-KO-2) cells were cultured in DMEM (BE12-614Q, Lonza) supplemented with 10 % Fetal Bovine Serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... A cell count ranging from 1 × 10^5 to 2 × 10^5 cells was collected and suspended in 15 µL of nucleofection buffer (Lonza). Electroporations were conducted in the strip format ...
-
bioRxiv - Immunology 2023Quote: ... CTLs derived from LifeAct-GFP expressing pmel-1 mice were incubated with peptide-loaded and IFNγ-treated B16 cells cultured in phenol red-free DMEM (Lonza) supplemented with 10% FBS on stage at 37°C ...
-
bioRxiv - Immunology 2024Quote: Ten micrograms of expression plasmid or 20 pmol of siRNA were introduced into 1 x 107 BMDC cells by electroporation using a Nucleofector 2b (Lonza) with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza) ...
-
bioRxiv - Bioengineering 2024Quote: ... B cells were edited 3-5 days after isolation or thawing using the Lonza Nucleofector 4D (program EO-117) using 1×106 cells per well of a 16-well Nucleocuvette Strip (Lonza). Immediately following nucleofection ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 × 106 wild-type K562 cells were electroporated in 100 μl of Amaxa solution (Lonza Nucleofector 2b, program T-016) with 1 µg of PiggyBac expression vector (PB200A-1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... together with a plasmid encoding the piggyBac transposase in a 3:1 ratio (vector:transposase) using the P3 Primary cell 4D-Nucleofector™ kit (Lonza). Prior to targeting ...
-
bioRxiv - Immunology 2022Quote: ... the protein extraction was done with IP buffer (50 mM Hepes pH 7,5 (Lonza), 150 mM NaCl (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: BMDMs (1 × 106 cells) were transfected with siRNA (250 pmol) and Amaxa Mouse Macrophage Nucleofector Kit (Lonza, catalog number VPA-1009) using a Lonza Nucleofector 2b device (Lonza ...
-
bioRxiv - Microbiology 2019Quote: ... the antibody-virus mixture was aspirated and Vero cells were washed with PBS and overlaid with DMEM containing 2% heat-inactivated FBS and 1% SeaPlaque Agarose (Lonza, 50501). After 4–6 days ...
-
bioRxiv - Genomics 2021Quote: ... Four aliquots of one million cells each per study subject were stimulated overnight for 12 hours in 1 ml X-VIVO™ 15 Serum-free Hematopoietic Cell Medium (Lonza) with 10 ul ImmunoCult™ Human CD3/CD28/CD2 T Cell Activator (STEMCELL Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 400,000 H9 cells for each condition were electroporated with 1 μg plasmid via a human stem cell nucleofector™ kit (VPH-5012) by Lonza AMAXA Nucleofector 2B.
-
bioRxiv - Microbiology 2022Quote: ... NuLi-1 cells routinely tested negative for mycoplasma infection using MycoAlert Mycoplasma Detection Kit (LT07-418, Lonza Group AG, Basel, Switzerland) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... ATCC #CRM-CRL-1420) and PANC-1 cells (CVCL_0480, ATCC #CRM-CRL-1469) were cultured in D10 media: DMEM (Lonza #12-614Q) supplemented with 10% FBS (GELifeSciences #SH30071.03) ...
-
bioRxiv - Immunology 2023Quote: ... vectors was performed on day 2 of activation into 1×106 T cells using 4D-Nucleofector according to the manufacturer’s instructions (Lonza, Cologne, Germany).
-
bioRxiv - Immunology 2023Quote: ... Cells enriched by Percoll density-dependent sedimentation were adjusted to a concentration of 1 × 106 cells/ml in serum-free X-VIVOTM 15 medium (Lonza BioWhittaker) containing 100 ng/ml recombinant human SCF (Peprotech ...
-
bioRxiv - Cell Biology 2024Quote: ... and a control siRNA (D-001810-01-20 ON-TARGET plus Nontargeting siRNA #1) were prepared for electroporation using the Lonza SF Cell Line 4D-Nucleofector™ X Kit (V4XC-2012; Lonza) according to the manufacturer’s instruction with minor alterations ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% of penicillin-streptomycin and 1% of Ultraglutamine-1 (Lonza, Basel, Switzerland). U-2 OS cells were grown in high-glucose DMEM (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: 1 million Jurkat cells were electroporated with the 2.5 μg of sgRNA plasmid and GFP control plasmid at a 10:1 ratio using an Amaxa Cell Line Nucleofector Kit V and an Amaxa™ Nucleofector™ II (Lonza). HeLa ...
-
bioRxiv - Developmental Biology 2020Quote: ... about 8 × 105 iPSCs were transfected with 5 μg of plasmids with Lonza Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012) on a Nucleofector 2b device (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... To generate IKZF3-deficient CAR-T cells, 15-20 million PBMCs in RPMI 1640 (10% FBS, 1% penicillin/streptomycin) were nucleofected using Nucleofector 2b (Lonza, Köln, Germany) with a mixture of 4 plasmids (5 μg each ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... complex with a ratio of 4.5 to 1 between sgRNA and Cas9 was delivered following the protocol of the SE Cell Line 4D-NucleofectorTM X Kit (Lonza, V4XC-1012), using the nucleofection program DS-130 on the Lonza 4D X unit ...
-
bioRxiv - Cell Biology 2021Quote: ... 500μg of gRNA and 500μg of donor plasmids were electroporated in 1×106 mESC using P3 Primary Cell 96-well Nucleofector™ Kit (Lonza, PBP3-22500) according to manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were electroporated with 10 µg lineage recorder DNA and 1 µg Sleeping Beauty transposase in 100 µl Human Stem Cell nucleofection buffer (Lonza, VVPH-5022) using the B-016 program of the 4D-Nucleofector (Lonza ...
-
bioRxiv - Biophysics 2022Quote: ... 106 U2OS cells were transfected with 1 μg of px330 plasmid and 1 μg of the HDR donor plasmid using the Nucleofector 2b device and cell line nucleofector kit V (Lonza, VCA-1003) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... and CDR3B gRNA (10 nmol) were used to transfect 1×108 TnT cells using the 4D-Nucleofector LV unit (Lonza, #AAF-1002L). TnT cells with restored CD3 surface expression were bulk-sorted (SEL 1 ...