Labshake search
Citations for Lonza :
3051 - 3100 of 3125 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... CRISPR-CAS9 knockout in SU-DIPGXIII cells was performed using the Amaxa P3 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-3012). First ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1.5 x 106 cells were transfected with 1 µg DNA (500 ng Cas9 plasmid and 500 ng linearized donor plasmid) by nucleofection (pulse code CA137) using P3 Primary Cell 4D-Nucleofector X kit (Lonza, V4XP-3024) in a 4D-Nucleofector (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... ePB master vector and helper (Plasmid AW-27) were nucleofected into the established SOX2::mCitrine cell line using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012). G-418 (40ng/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... Purified templates together with 2 µg of LentiGuide-Gbp-Chr3-sg3+sg4 were electroporated into RAW-Cas9 cells using Lonza SF cell line X kit (Lonza, V4XC-2012) on a Lonza 4D-Nucleofector unit (Lonza) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100,000 MCF10a cells was nucleofected with program DS-138 using an Amaxa 4D-Nucleofector X using the SE Cell Line 4D X Kit S 32 RCT (Lonza V4XC-1032). Reactions were split between two 24-well plates and grown in complete media three days ...
-
bioRxiv - Microbiology 2023Quote: ... with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Guides targeting CCNT1 were complexed with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Genomics 2023Quote: ... was mixed with 16.4 μL Nucleofector SolutionTM and 3.6 μL Supplement and incubated at room temperature for about 10 min according to the instruction of Amaxa 4D-Nucleofector X Kit TM (Lonza, #V4XP-3032). HepG2 ...
-
bioRxiv - Microbiology 2023Quote: ... cells then were electroporated using electroporation code EH-100 and using the P3 Primary Cell 96-well Nucleofector Kit (Lonza, V4SP-3096). Knockout pools were maintained for an additional nine days prior to coculturing with H80 feeder cell line with IL-2 (Final conc 20 U/mL ...
-
bioRxiv - Cell Biology 2023Quote: PMOs were dissolved in distilled water and transfected into RD cells using the Amaxa Cell Line Nucleofector Kit L and a Nucleofector II electroporation device (Lonza, Basel, Switzerland) with program T-030 or into cells from a DMD patient without a transfection reagent.
-
bioRxiv - Bioengineering 2023Quote: ... 100,000 cells were resuspended in 20μl P3 reagent of the P3 Primary Cell 4D-Nucleofector® X Kit S (Lonza V4XP-3032). 1 μg total plasmid was used for a single nucleofection event and nucleofected by program EH-100 ...
-
bioRxiv - Cell Biology 2023Quote: ... The linearized construct and the purified schizonts were mixed with Nucleofector solution from an Amaxa human T cell Nucleofector Kit and electroporated using the Amaxa Nucleofector II device (Lonza, Köln, Germany). Directly after transfection 50 µl RPMI-1640 complete was added to the transfection reaction followed by intravenous injection into one SWISS mouse ...
-
bioRxiv - Genomics 2023Quote: ... 200,000 cells were nucleofected with 50 fmol transposon and 50 fmol transposase (Super piggyBac Transposase - SystemBio PB210PA-1) or with 300 ng pmaxGFP using the P2 Primary Cell 4D Nucleofector kit (Lonza V4SP-2096) and the Lonza 4D- Nucleofector with the DS-150 program ...
-
bioRxiv - Genomics 2023Quote: ... Each plasmid library was transfected into K562 or A549 cells by electroporation using Lonza SF Cell Line 4D-Nucleofector X Kit (Lonza V4XC-2012) with Lonza 4D-Nucleofector ...
-
The spindle protein CKAP2 regulates microtubule dynamics and ensures faithful chromosome segregationbioRxiv - Cell Biology 2023Quote: ... and immediately transfected by Nucleofection into HT-1080 cells using the Amaxa SF Cell Line 4D-Nucleofector X kit S (Lonza, PBC2-00675) and either program FF-113 (HT1080 ...
-
bioRxiv - Genetics 2023Quote: ... The media was removed from the cell pellet and cells were resuspended according to the protocol provided for the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... Constructs were transiently transfected into KRT17 null A431 cells using the SF Cell Line 4D-Nucleofector™ X Kit (Lonza #V4XC-2032) and Lonza 4D-nucleofector X unit “A431 cell” program ...
-
bioRxiv - Genetics 2024Quote: ... 3x105 Daudi cells were nucleofected with 20 picomole of sgRNA-Cas9 complex and 100 picomole of DNA donor template using program CA137 of Amaxa 4D-Nucleofector and SF cell line kit S (Lonza, V4XC-2032). The edited single-cell clones were sorted into 96-well plate by BD Aria II sorter and expanded for 4 weeks ...
-
bioRxiv - Cell Biology 2024Quote: ... was transfected into 106 U2OS cells using the Amaxa Nucleofector System with the Cell Line Nucleofector Kit V (catalog no: VCA-1003, Lonza, Cologne, Germany) utilizing program X-001 according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1.2 μl of Alt-R® Cas9 Electroporation enhancer (100 μM, IDT) using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza). After electroporation ...
-
bioRxiv - Systems Biology 2024Quote: ... HiFi Cas9 Nuclease V3 protein (IDT, 1081058) were introduced into low-passage dual-reporter ESCs using the Mouse Embyronic Stem Cell Nucleofector Kit (Lonza VPH-1001). ESCs were treated with 0.025% trypsin/1% EDTA (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... the Ribonucleoprotein (RNP) complexes (9:1 sgRNA to Cas9 ratio) were assembled in Nucleofector Solution plus Supplement (Lonza Amaxa HMEC Nucleofector Kit) to a total volume of 100µL ...
-
bioRxiv - Cell Biology 2024Quote: ... In microscopy experiments we used the same media but without phenol red to reduce background fluorescence (Lonza CC-3153 phenol-red free basal media supplemented with growth factors and other components from the Lonza CC4136 kit). T98G cells were purchased from ATCC ...
-
bioRxiv - Genomics 2020Quote: ... 2*106 TX1072 mESCs were electroporated with 2µg of each guide plasmid and 30pmol of the single stranded repair oligo using the P3 Primary Cell 4D-Nucleofector X Kit (V4XP-3024) with the Amaxa 4D Nucleofector system (Lonza, program CP-106) and plated on gelatin-coated 10cm dishes ...
-
bioRxiv - Cancer Biology 2019Quote: ... PrEC cells were cultured in Prostate Epithelial Cell Basal Medium (PrEGM) supplemented with Prostate Epithelial Cell Growth Kit (Clonetics™ PrEGM™, BulletKit™, Lonza). All cell cultures were maintained at 37°C in an incubator with a controlled humidified atmosphere composed of 95% air and 5% CO2.
-
bioRxiv - Immunology 2019Quote: ... two PX330-GFP vectors coding different CD80 sgRNA were electroporated into wild-type Raji cells (CD80+/CD86+/PD-L1-) using Cell Line Nucleofector Kit V (LONZA, catalog VACA-1003). Electroporated cells were recovered for two days at 37 °C/5% CO2 ...
-
bioRxiv - Neuroscience 2019Quote: ... Cortical neurons from C57BL/6J and C57BL/6J Sorcs1flox/flox mice were electroporated with DNA just before plating using an AMAXA Nucleofector kit (Lonza, Cat #VPG-1001). Cortical neurons from C57BL/6J Sorcs1flox/flox mice were transfected at DIV7 using Effectene (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... two pairs of sgRNA vectors and Cas9 nickase plasmid were transduced into the AD hPSCs by using Human Stem Cell Nucleofector® Kit 1 (Lonza VPH-5012). Three days after electroporation ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 × 106 cells were resuspended in 100 μl of the nucleofection hESC solution 1 (Human Stem Cell Nucleofector® Kit 1/ Lonza #VPH-5012) where 5 μg of plasmids were added previously ...
-
bioRxiv - Cancer Biology 2020Quote: ... A total of 1.5×106 tumor cells (td-tomato MDA-MB-231 SORE6>GFP) were transfected with 10 μl of 20 μM siRNA stock solution using Nucleofector Kit V from Lonza (cat# VCA-1003) for 48 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and pCXLE-hUL (#27080) were transfected into fibroblasts using a 4D-Nucleofector system with P2 Primary Cell 4D-Nucleofector X Kit (Lonza; program DT-130). Three to five weeks after reprogramming ...
-
bioRxiv - Immunology 2022Quote: ... The Cas9 protein and sgRNA were electroporated into the T cells by using Amaxa 4D-Nucleofector System and P4 Primary Cell 4D-Nucleofector® X Kit S (Lonza, V4XP-4032) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... For CENP-C overexpression we transfected HeLa cells with pEGFP-CENP-C using the Amaxa Cell Line Nucleofector Kit R (Lonza cat#VVCA-1001) per manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: 3T3 cells were transfected with either hACE2 or GFP mRNA using an Amaxa cell line nucleofector L kit (Lonza; catalog number VCA-1005) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... E14 mESC founder lines carrying the piggyBac transgene were generated using nucleofection with the Amaxa 4D-Nucleofector X-Unit and the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, V4XP-3024 KT). 2×106 cells were harvested with accutase (Sigma Aldrich ...
-
bioRxiv - Genomics 2021Quote: ... E14 cells were transfected with this plasmid library using a Nucleofector™ 2b device using the Mouse ES Cell Nucleofector Kit (Lonza, VAPH-1001). For each of the three biological replicates ...
-
bioRxiv - Cancer Biology 2022Quote: ... the cells were then additionally nucleofected with ribonuclease complex of ITGB2 sgRNA and Cas9 using P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza, V4XP-3032) using 4D-Nucleofector (Lonza ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the gRNA vector PX330-EN1082 using nucleofection with the Amaxa 4D-Nucleofector X-Unit and the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, V4XP-3024 KT) as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... was transfected with the targeting vector pUC19-ITR-NeoR-ITR-3xCTCF-LacO and the gRNA vector pX330-chr15_LacO_gRNA/Cas9 using nucleofection with the Amaxa 4D-Nucleofector X-Unit and the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, V4XP-3024 KT) as described for the Tir1 integration ...
-
bioRxiv - Molecular Biology 2022Quote: ... were transfected with the targeting vector pMK-3xCTCF-TetO-Rox-PuroR-Rox and the gRNA vector PX459-chr15_gRNA/Cas9 using nucleofection with the Amaxa 4D-Nucleofector X-Unit and the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, V4XP-3024 KT). 2×106 cells were nucleofected with 1 μg TetO targeting vector and 1 µg of PX459-ch15_gRNA/Cas9 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of 1E6 cells were resuspended with 20ul supplemented nucleofector solution of the P3 Primary Cell 4D-nucleofector® X Kit S (Lonza, V4XP-3032) and 2ug plasmid (1ug/ul) ...
-
bioRxiv - Immunology 2022Quote: ... Activated cells were nuclofected with 100 µM AhR or non-targeting (NT1) siRNA (ON-TARGETplus SMART pool, Dharmacon) using the Amaxa Human T cell Nucleofector Kit (Lonza, Walkersville, MD, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... PiggyBac transposon constructs and RNA encoding transposase were introduced into T cells by electroporation using a Lonza 4D-Nucleovector instrument and the P3 Primary Cell Kit (Lonza, Cat. # V4XP-3032). Electroporated T cells were immediately seeded into 24-well G-Rex plates (Wilson Wolf ...
-
bioRxiv - Neuroscience 2024Quote: ... sgRNA plasmids validated by Sanger sequencing were transfected into SH-SY5Y cells using nucleofection (SF Cell Line 4D-Nucelofector X kit, Lonza, Germany, V4XC-2012) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... MC38 Pdl1 KO cells were generated through CRISPR Cas9-gRNA RNP-directed deletion by using a Lonza 4D-Nucleofector and a SF Cell Line 4D-Nucleofector X Kit S (Lonza, cat. V4XC-2032). In brief ...
-
bioRxiv - Immunology 2024Quote: ... The nucleofection was conducted using a Lonza 4D-Nucleofector and a P3 Primary Cell 4D-Nucleofector X Kit S (Lonza, cat. V4XP-3032) with the same protocol described earlier ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmids expressing ETS1 sgRNAs (see Supplemental Table S1) were co-electroporated into the dCas9-VP64-expressing cells using the AmaxaTM Cell Line Nucleofector™ Kit R (Lonza, VCA-1001) and further subjected to puromycin selection and single-cell cloning ...
-
bioRxiv - Biophysics 2023Quote: ... we transfected HeLa cells with SNAP-tagged CENP-A (generous gift from Dan Foltz) in combination with either empty vector or GFP-CENP- C using the Amaxa Nucleofector kit R (Lonza Bioscience, Walkersville, MD) per instructions.
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: SQD9 cells were transfected with PX459 using Nucleofector™ 2b Device and Cell Line Nucleofector™ Kit L (Lonza, #AAB-1001, #VACA-1005). Cas9-expressing cells were selected with 0.625 µg/mL puromycin (Thermo Fisher ...