Labshake search
Citations for Lonza :
2851 - 2900 of 3125 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... were nucleofected with 2 µg of each sgRNA/Cas9 plasmid and 3 pmol or 30 pmol (for E14-STNΔTsixP) repair oligo (Supplementary Table 6) using the Lonza 4D-Nucleofector with the P3 Primary Cell 4D-NucleofectorTM kit (Lonza) and CP-106 (for TXΔXertP and E14-STNΔTsixP ...
-
bioRxiv - Genetics 2020Quote: ... 2×105 UE control hPSCs were transfected with a pair of pSpCas9(BB)-2A-GFP constructs containing the specific sgRNAs (350 ng per construct) using P3 Primary Cell 4D-Nuclecfector X Kit (Lonza). The transfected cells were plated in Matrigel-coated dish and cultured for 2 days ...
-
bioRxiv - Immunology 2019Quote: ... HA-PLD1 or myc-PLD2 using Amaxa® Cell Line Nucleofector® Kit V reagent (cat. # VCA-1003, Lonza, Switzerland).
-
bioRxiv - Immunology 2019Quote: ... The U937 cells were electroporated using Lonza Nucleofector 2b (program W-001) and the Nucleofection Kit C (Lonza, VPA-1004). After electroporation ...
-
bioRxiv - Genetics 2021Quote: ... were transfected with either KMT2D CRISPR-Cas9 vector or CRISPR-Cas9 empty vector together with GFP plasmid using P3 Primary Cell 4D-Nucleofector X kit (V4XP-3024, Lonza). Three days after transfection ...
-
bioRxiv - Genetics 2021Quote: ... first excised floxed Neomycin resistance cassette from Oct4 (CiA:Oct4) mESCs 12 by transfecting Cre-mCherry plasmid using Mouse Embryonic Stem Cell Nucleofector™ Kit from Lonza. After 24 hours after transfection ...
-
bioRxiv - Genetics 2021Quote: ... Cas9-sgRNA-Thy1.1 plasmid transfection was carried out by electroporation using Mouse Embryonic Stem Cell Nucleofector™ Kit from Lonza. After 36 hours of transfection Thy1.1 expressing cells were FACS sorted and sparsely seeded for clonal expansion on 15cm plate ...
-
bioRxiv - Developmental Biology 2020Quote: ... Guide RNA vectors were nucleofected into the LaminB CRISPRi iPSC line using a P3 Primary Cell 96-well NucleofectorTM Kit (Lonza) and the 4D Nucleofector X Unit (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... Activated cells were transfected using the Human T cell Nucleofector Kit (Amaxa Biosystem, #VPA-1002) and the Amaxa Nucleofector II system (Lonza), Program T-023 with ribonucleoprotein complexes ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of PBMCs: ASOs were electroporated into PBMCs using the Human T cell nucleofector kit (VPA-1002, Lonza, Basel, Switzerland). Transfection of TILs ...
-
bioRxiv - Immunology 2021Quote: ... 1 × 106 NALM6 target cells were transfected with 1 μg plasmid using the Nucleofector 4D (SF cell line Kit, program CV-104, Lonza) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg of plasmid DNA was introduced to 4×106 neurons using an AMAXA nucleofection kit (VPG-1001, VPG-1003; Lonza). AMAXA-nucleofected cells were plated in 35mm glass bottom imaging dishes ...
-
bioRxiv - Immunology 2021Quote: ... were transfected with 500 ng plasmid encoding pAcGFP-fused CDC42 variants or hMEFV-pAcGFP1-t2a-CDC42 using 4D-Nucleofector and the SG Cell Line 4D-Nucleofector X Kit (Lonza). Immediately after nucleofection ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were nucleofected with 1 nmol ASO against MERVL or Scramble ASO using P3 Primary Cell 96-well Nucleofector Kit (Lonza) according to manufacturer’s instruction and seeded into each well of a 24-well plate containing 500 µl of ESC medium with 2i ...
-
bioRxiv - Genetics 2022Quote: ... The cells were treated with a dose range of high molecular weight poly(I:C) (1.5-8kb; 1mg/mL stock) by nucleofection following manufacturer’s instructions (Lonza 4D-NucleofectorTM Kits). Gene expression of the indicated genotypes was assessed by SYBR green based qPCR as described previously.
-
bioRxiv - Biophysics 2022Quote: ... The transfected cells were then co-cultured with BHK-21 cells (ATCC CCL-10) transfected with VSV-G using the SE cell Line 4D-Nucleofector X Kit L (Lonza) and cultured until virus-mediated CPE was observed ...
-
bioRxiv - Bioengineering 2022Quote: ... 90 μL of nucleofection solution (16.2 μL of Supplement solution mixed with 73.8 μL of SF solution from SF Cell Line 4D-Nucleofector™ X Kit L) (Lonza) was mixed thoroughly with the cell pellet ...
-
bioRxiv - Cell Biology 2022Quote: ... were plated in collagen-coated plastic and cultured in cell-specific basal media supplemented with a growth media kit (PromoCell; Lonza) and 5% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Immunology 2022Quote: ... we used SF Cell Line 4D-Nucleofector™ X Kit L (for Raw 264.7 cells) or SG Cell Line 4D-NucleofectorTM X Kit L (for NIH/3T3 cells; both from Lonza Inc.). Up to 5 × 106 cells were resuspended in 100 μl of nucleofection solution ...
-
bioRxiv - Neuroscience 2022Quote: ... The OPC cell cultures were regularly tested to be mycoplasma free using a MycoAlert Mycoplasma Detention Kit (Lonza, LT07-118). The OPCs were authenticated with immunopositivity for OPC cell markers (Nkx2—2 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... T cells were resuspended in P3 buffer (0.75-1 x 106 cells per 18 μl P3) from the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). 10 μg/μl Alt-R S.p ...
-
bioRxiv - Neuroscience 2022Quote: ... neurons were transfected by electroporation before seeding with target siRNA or ntRNA using a 4D-Nucleofector X Unit and the corresponding P3 Primary Cell nucleofection kit (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... transfection was performed with 3.5 μg of PF16eYFPNeo introduced into 108 cells using a Human T-cell kit and IIb Nucleofector set to program X-001 (Lonza). Other transfections described in this work used the same conditions except with Tb-BSF buffer (90 mM sodium phosphate ...
-
bioRxiv - Immunology 2022Quote: ... Electroporation was performed using the Amaxa P3 Primary Cell 96-well Nucleofector kit and 4D-Nucleofecter (Lonza, Walkersville, MD, USA). crRNAs were selected from CRISPR sgRNA database of (Genscript ...
-
bioRxiv - Cancer Biology 2022Quote: ... Generation of the MDA-MB-231 HAS overexpressing cells was conducted using either the pPB huHAS2-IRES2-mScarlet-IRES2-NeoR or pPB huHAS3-IRES2-mScarlet-IRES2-NeoR or with the Piggybac transponase using the Nucleofector Cell Line Kit V (Lonza). Stably transfected cells were selected using 1 μg/mL puromycin (MilliporeSigma ...
-
bioRxiv - Neuroscience 2022Quote: Neurons were nucleofected with identified plasmids prior to plating at 0 DIV using Amaxa Rat Neuron Nucleofector kit (DGP-1003; Lonza) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Those cells were cultured in DPSC growth medium (DPSC-GM) by adding the contents of a DPSC SingleQuots Kit (PT-4516; Lonza) to DPSC Basal Medium (DPSC-BM ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were nucleofected with plasmids of interest using the Lonza 2b Nucleofector and Rat cardiomyocyte Nucleofector Kit (Lonza, VAPE-1002) according to the manufacturer’s instruction.
-
bioRxiv - Neuroscience 2023Quote: ... Neurons were nucleofected with plasmids of interest using the Lonza 2b Nucleofector and Rat Neuron Nucleofector Kit (Lonza, VPG-1003) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell and siRNA mixture resuspended in 100 µl of Nucleofector Solution for Human Keratinocytes provided with Human Keratinocyte Nucleofector kit (VPD-1002, Lonza). Nucleofection performed on program X-001 of Amaxa Biosystems Nucleofector II electroporator transfection unit ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 × 106 OSCs were transfected with 4 μg of pPB-TRE3G-FLAG-Rhino-Tjen-trTA-P2A-BlastR and 1 μg of pHsp70-Myc-hyPBase using Nucleofector Kit V (Lonza). After incubation in media containing blasticidin (50 μg/mL) ...
-
bioRxiv - Neuroscience 2024Quote: ... The RNP complex was subsequently transfected into dissociated iPSCs by electroporation with Lonza Nucleofector 2B using the Amaxa Human Stem Cell Nucleofector Starter Kit (Lonza) according to manufacturer’s manual ...
-
bioRxiv - Genomics 2024Quote: Transfections of DNA constructs in ESCs were performed using the P3 Primary Cell 4D-Nucleofector X Kit (V4XP-3024) and the Amaxa 4D Nucleofector system (Lonza). For each nucleofection ...
-
bioRxiv - Microbiology 2024Quote: Raw264.7 CRISPR cells were generated by electroporation of low passage Raw264.7 cells with Dhx58 and Ifih1 pSBtet-puro-Cas9-U6 using Amaxa Nucleofector II and Amaxa Cell Line Nucleofector Kit V (Lonza). Cells were selected with puromycin 3 days post-nucleofection ...
-
bioRxiv - Cell Biology 2023Quote: ... and Cas9-GFP were then transfected into human iPSCs for INS mutation correction using embryonic stem cell Nucleofector Kit (VVPH-5012, Lonza). Transfected cells were cultivated in StemFlex medium (catalog #A3349401 ...
-
bioRxiv - Immunology 2024Quote: ... Plasmids were sequenced at the OHSU sequencing core and transfected into BEAS-2B MR1-/- cells using the Amaxa nucleofection system with Kit T solution (Lonza). The transfection efficiency was evaluated via GFP expression by flow cytometry (Supplementary Figure 4) ...
-
bioRxiv - Immunology 2024Quote: ... were nucleofected into 1e6 BEAS-2B WT cells at 300 nM according to the manufacturer’s instructions (Lonza, Nucleofector Kit T). Cells were allowed to rest overnight (TAPBPR and tapasin ...
-
bioRxiv - Cancer Biology 2023Quote: ... twice and resuspended in Cell Line Nucleofector solution SF (16.4uL) with Supplement (3.6uL) (SF Cell Line 4D-nucleofector X Kit, Lonza, V4XC-2032). Alt-R SpCas9 nuclease (100pmol ...
-
bioRxiv - Neuroscience 2023Quote: Transfection of dissociated neurons was performed using the AMAXA Nucleofector system (program O.005) with the mouse neuron Nucleofector kit (Lonza) following the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in 90 µL of nucleofection solution (16.2 µL of Supplement solution mixed with 73.8 µL of SF solution from SF Cell Line 4D-Nucleofector™ X Kit L) (Lonza), transferred to the 15 µL RNP solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were resuspended in respective electroporation/nucleofection buffer (HEK293T cells and HepG2 SF Buffer (SF Cell Line 4D-Nucleofector X Kit, Lonza), Jurkat cells SE buffer (SE Cell Line 4D-Nucleofector X Kit ...
-
bioRxiv - Microbiology 2023Quote: Constructed plasmids encoding AS1-S were introduced into MDBK cells using Amaxa cell line Nucleofector kit R (Lonza, Kanagawa, Japan) with Amaxa Nucleofector II system in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... isolated WT P14 CD8+ T cells were washed with PBS and mixed with RNPs by using P3 Primary Cell 4D-NucleofectorTM X Kit (Lonza) immediately prior to electroporation (Lonza 4D-nucleofactorTM core unit ...
-
bioRxiv - Neuroscience 2023Quote: ... 01F49i-N-B7 iPSCs were dissociated to single cells and 250,000 cells transfected with 25 μL of the prepared transfection mix containing 20 µL of nucleofection buffer (P3 Primary Cell 4D-NucleofectorTM X Kit S, Lonza), 5 µL of the RNP complex ...
-
bioRxiv - Immunology 2023Quote: CRISPR–Cas9 gene knockout was performed by transient Cas9/gRNA (RNP) complex electroporation using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). On day 4 of culture ...
-
bioRxiv - Genomics 2023Quote: ... 2.5e5 RPE1 CRISPRi cells were nucleofected with 3μM RNP complex using an SE Cell Line 4D X Kit S (Lonza Bioscience) on a 4D-Nucleofector (Lonza Bioscience ...
-
bioRxiv - Immunology 2023Quote: Hepatocytes (7×105 cells) were transfected with various plasmids (at 6 μM or indicated concentrations) using the Mouse/ Rat hepatocyte Nucleofector kit (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... Neurons were nucleofected with 10 µ total DNA plasmid DNA using the AD1 4D-Nucleofector Y kit (Lonza V4YP-1A24) with the ED158 (iCell GlutaNeurons ...