Labshake search
Citations for Lonza :
2701 - 2750 of 2809 citations for BCA Protein Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Point mutations were introduced into CJ7 WT using CRISPR RNP transfected into cells with the Amaxa mouse ES kit (Lonza VPH-1001). 1×106 cells were transfected with the RNP containing two separate guide RNAs a single stranded donor oligo and a linearized puromycin resistance gene ...
-
bioRxiv - Immunology 2020Quote: ... 106 cells per condition were nucleofected with 4 µg of DNA using the Amaxa Nucleofector II (Lonza, Kit R; program R-024). Nucleofected cells were allowed to recover for 24-48 hours before sorting for GFP positivity and lack of CD56 expression.
-
bioRxiv - Microbiology 2021Quote: ... the Sleeping Beauty transposase system [37] was adapted to electroporate Jurkat cells using the Lonza SE Cell Line kit (Lonza, V4SC-1960). The pSBbi-RP plasmid was a gift from Eric Kowarz (Addgene plasmid #60513 ...
-
bioRxiv - Immunology 2019Quote: ... conjugated to FITC or GFP siRNA (300 nM) conjugated to FITC two days prior to adoptive T cell therapy using the Mouse T cell Nucleofector™ Kit (Lonza Bioscience) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: ... as a control two days prior to adoptive T cell therapy using the P3 Primary Cell 4D-Nucleofector X™ Kit (Lonza Bioscience) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... 2×105 cells were co-transfected with 2ug of the Cas9/sgRNA vector PxHF1* and 4 ul of ssODN HDR template (20 uM) using a Lonza X-Unit Nucleofector with P3 buffer kit (Lonza #V4XP-3032). Four days following transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and the GFP-K17ΔNLS (Hobbs et al., 2015) were nucleofected into HeLa cells using SE Cell Line 4D X nucleofector Kit S (Lonza #V4XC-1032) with setting DS-138 ...
-
bioRxiv - Neuroscience 2021Quote: ... Single-cell suspension of hiPSCs was nucleofected with 5 μg of the generated SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: ... 500 µl of cell media was collected and the presence of adenylate kinase was measured with the ToxiLightTM cytotoxicity assay kit (Lonza, Basel, Switzerland) to check the integrity of the cell membrane ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... Fast-growing clonal cell lines confluent after three weeks of growth were expanded and confirmed to be mycoplasma-negative using the Myco-Alert PLUS kit (Lonza, Basel, Switzerland) prior to freezing for long-term storage in liquid nitrogen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... plasmids pSpCas9n(BB)-ZEB2-Guide-A &-B (0.5 µg of each plasmid) were electroporated into 1×106 H9 cells using the Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012). Following electroporation ...
-
bioRxiv - Molecular Biology 2020Quote: pSBbi-Pur-ABCC1 or empty vector were cotransfected with SB100X using the same Amaxa Nucleofector II and kit V (Lonza Group AG). Stably expressing cells were selected for using 10ug/mL puromycin (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg of sgRNA and 5 µg of ssDNA donor template (Table S1) using Human Stem Cell NucleofectorTM kit 1 (Lonza, VVPH-5012) according to the manufactures protocol and cells replated ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transfected with pcDNA3.1 empty vector or pcDNA3.1 containing the human coding sequence of the VGLL2-NCOA2 fusion using the AMAXA cell line Nucleofection kit V (Lonza #VCA-1003;) and were selected in growth media containing 1μg/ml concentration of G418 (ThermoFisher #10131035) ...
-
bioRxiv - Immunology 2021Quote: ... gRNA_pX335 plasmids were transfected into EL4 cells by nucleofection using an Amaxa nucleofector and the Cell Line Nucleofector Kit L (Lonza, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... transfection of primary T cells with Cas9 RNP complexes and GSH1/GSH2-mRuby HDR templates was performed using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... dissociated ganglia were pelleted at 100 x g for 5 min and resuspended in 100 µl ‘Nucleofector solution’ (Rat Neuron Nucleofector kit; Lonza, Alpharetta, GA). 4-6 μg of plasmid was electroporated using the AMAXA Nucleofector device (Neurons Rat DRG ...
-
bioRxiv - Developmental Biology 2022Quote: ... D-001206-14-05 5 nmol) and nucleofected into OPCs using the Basic Nucleofector Kit for Primary Mammalian Glial Cells (Lonza, VPI-1006) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were co-transfected with 1 ug of firefly Luciferase vector and 0.1 ug Renilla luciferase vector by nucleofection with Lonza Cell Line Nucleofector® Kit V (Lonza, #VVCA-1003) and the T-020 program in the Amaxa Nucleofector II device ...
-
bioRxiv - Biochemistry 2022Quote: Normal bronchial epithelial cells (BEAS-2B / ATCC-CRL-9609) were cultured in collagen coated flasks using the bronchial epithelial growth medium supplemented with Lonza Bullet Kit (BEGM, Lonza CC-3170), as described by ATCC culture instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The plasmids were co-transfected into H9 hESC cells using the Amaxa 4D nucleofector (#AAF-1003B and #AAF-1003X) and the P3 Primary Cell 4D-Nucleofector X kit (Lonza, #V4XP-3024).
-
bioRxiv - Molecular Biology 2022Quote: ... using nucleofection with the Amaxa 4D-Nucleofector X-Unit and the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, V4XP-3024 KT). 2×106 cells were harvested using accutase (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were authenticated by STR testing upon receipt and were routinely tested and verified as mycoplasma negative using the MycoAlert kit (Lonza, Cambridge, MA). Human recombinant TNF was purchased from BioLegend Inc (San Diego ...
-
bioRxiv - Cancer Biology 2024Quote: ... CRISPR-CAS9 knockout in SU-DIPGXIII cells was performed using the Amaxa P3 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-3012). First ...
-
bioRxiv - Synthetic Biology 2024Quote: Electroporation was done 7 days after stimulation by DynaBeads using a P3 Primary Cell 4D-Nucleofector™ X Kit (Lonza #V4XP-3012). 750 ng of HDR template was mixed with 50 pmol of RNP and incubated at room temperature for 10 minutes ...
-
bioRxiv - Genomics 2024Quote: ... and electroporated with 6 μg of gRNA-Cas9 expression vector and 3 μg of SNRPN targeting vector using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3032). Transfected cells were plated into a 10 cm dish coated with Matrigel (Corning ...
-
bioRxiv - Genomics 2024Quote: ... were complexed for 20 minutes at room temperature and were nucleofected into 5E5 PEmax parental cells using the SE Cell Line 4D-Nucleofector X Kit (Lonza V4XC-1032) and program FF-120 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were resuspended in 20 µl nucleofection buffer (16.4 µl Nucleofector® Solution + 3.6 µl Supplement) provided in P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza, V4XP-3032). After the addition of 3 µl RNP and 0.5 µl of Alt-R Cas9 Electroporation Enhancer (IDT ...
-
bioRxiv - Genetics 2023Quote: ... The media was removed from the cell pellet and cells were resuspended according to the protocol provided for the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024). Briefly ...
-
bioRxiv - Genomics 2023Quote: ... 200,000 cells were nucleofected with 50 fmol transposon and 50 fmol transposase (Super piggyBac Transposase - SystemBio PB210PA-1) or with 300 ng pmaxGFP using the P2 Primary Cell 4D Nucleofector kit (Lonza V4SP-2096) and the Lonza 4D- Nucleofector with the DS-150 program ...
-
bioRxiv - Immunology 2022Quote: LPS concentration in serum was determined using a chromogenic assay based on a Limulus amebocyte extract (LAL kit-terminal QCL1000) (LONZA, Basel, Switzerland). Samples were collected at the time of euthanasia via cardiac puncture to try to minimize as much as possible the chance of contamination ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... ePB master vector and helper (Plasmid AW-27) were nucleofected into the established SOX2::mCitrine cell line using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012). G-418 (40ng/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Genomics 2023Quote: ... was mixed with 16.4 μL Nucleofector SolutionTM and 3.6 μL Supplement and incubated at room temperature for about 10 min according to the instruction of Amaxa 4D-Nucleofector X Kit TM (Lonza, #V4XP-3032). HepG2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 100,000 MCF10a cells was nucleofected with program DS-138 using an Amaxa 4D-Nucleofector X using the SE Cell Line 4D X Kit S 32 RCT (Lonza V4XC-1032). Reactions were split between two 24-well plates and grown in complete media three days ...
-
bioRxiv - Microbiology 2023Quote: ... with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Guides targeting CCNT1 were complexed with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Microbiology 2023Quote: ... cells then were electroporated using electroporation code EH-100 and using the P3 Primary Cell 96-well Nucleofector Kit (Lonza, V4SP-3096). Knockout pools were maintained for an additional nine days prior to coculturing with H80 feeder cell line with IL-2 (Final conc 20 U/mL ...
-
bioRxiv - Immunology 2023Quote: ... Purified templates together with 2 µg of LentiGuide-Gbp-Chr3-sg3+sg4 were electroporated into RAW-Cas9 cells using Lonza SF cell line X kit (Lonza, V4XC-2012) on a Lonza 4D-Nucleofector unit (Lonza) ...
-
bioRxiv - Cell Biology 2023Quote: PMOs were dissolved in distilled water and transfected into RD cells using the Amaxa Cell Line Nucleofector Kit L and a Nucleofector II electroporation device (Lonza, Basel, Switzerland) with program T-030 or into cells from a DMD patient without a transfection reagent.
-
bioRxiv - Molecular Biology 2023Quote: Induced pluripotent stem cells were transfected with a total of 5 μg target Cas9/gRNA plasmids with or without 1 μg repair templates using Human Stem Cell Nucleofector Kit (LONZA, Basel, Switzerland) and Nucleofector 2b device (LONZA ...
-
bioRxiv - Cell Biology 2023Quote: ... The linearized construct and the purified schizonts were mixed with Nucleofector solution from an Amaxa human T cell Nucleofector Kit and electroporated using the Amaxa Nucleofector II device (Lonza, Köln, Germany). Directly after transfection 50 µl RPMI-1640 complete was added to the transfection reaction followed by intravenous injection into one SWISS mouse ...
-
bioRxiv - Genomics 2023Quote: ... Each plasmid library was transfected into K562 or A549 cells by electroporation using Lonza SF Cell Line 4D-Nucleofector X Kit (Lonza V4XC-2012) with Lonza 4D-Nucleofector ...
-
The spindle protein CKAP2 regulates microtubule dynamics and ensures faithful chromosome segregationbioRxiv - Cell Biology 2023Quote: ... and immediately transfected by Nucleofection into HT-1080 cells using the Amaxa SF Cell Line 4D-Nucleofector X kit S (Lonza, PBC2-00675) and either program FF-113 (HT1080 ...
-
bioRxiv - Bioengineering 2023Quote: ... 100,000 cells were resuspended in 20μl P3 reagent of the P3 Primary Cell 4D-Nucleofector® X Kit S (Lonza V4XP-3032). 1 μg total plasmid was used for a single nucleofection event and nucleofected by program EH-100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... MCF-10A human mammary gland cells were used as the non-tumorigenic control and were cultured in MEBM basal medium supplemented with components included in the MEGMTM Mammary Epithelial Cell Growth Medium SingleQuotsTM Kit (Lonza, Hayward, CA). A549 human lung carcinoma cells were cultured in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Immunology 2023Quote: ... Constructs were transiently transfected into KRT17 null A431 cells using the SF Cell Line 4D-Nucleofector™ X Kit (Lonza #V4XC-2032) and Lonza 4D-nucleofector X unit “A431 cell” program ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1.5 x 106 cells were transfected with 1 µg DNA (500 ng Cas9 plasmid and 500 ng linearized donor plasmid) by nucleofection (pulse code CA137) using P3 Primary Cell 4D-Nucleofector X kit (Lonza, V4XP-3024) in a 4D-Nucleofector (Lonza ...