Labshake search
Citations for Lonza :
2551 - 2600 of 2809 citations for BCA Protein Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Constructed plasmids encoding AS1-S were introduced into MDBK cells using Amaxa cell line Nucleofector kit R (Lonza, Kanagawa, Japan) with Amaxa Nucleofector II system in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... isolated WT P14 CD8+ T cells were washed with PBS and mixed with RNPs by using P3 Primary Cell 4D-NucleofectorTM X Kit (Lonza) immediately prior to electroporation (Lonza 4D-nucleofactorTM core unit ...
-
bioRxiv - Neuroscience 2023Quote: ... 01F49i-N-B7 iPSCs were dissociated to single cells and 250,000 cells transfected with 25 μL of the prepared transfection mix containing 20 µL of nucleofection buffer (P3 Primary Cell 4D-NucleofectorTM X Kit S, Lonza), 5 µL of the RNP complex ...
-
bioRxiv - Immunology 2023Quote: CRISPR–Cas9 gene knockout was performed by transient Cas9/gRNA (RNP) complex electroporation using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). On day 4 of culture ...
-
bioRxiv - Genomics 2023Quote: ... 2.5e5 RPE1 CRISPRi cells were nucleofected with 3μM RNP complex using an SE Cell Line 4D X Kit S (Lonza Bioscience) on a 4D-Nucleofector (Lonza Bioscience ...
-
bioRxiv - Immunology 2023Quote: Hepatocytes (7×105 cells) were transfected with various plasmids (at 6 μM or indicated concentrations) using the Mouse/ Rat hepatocyte Nucleofector kit (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... Neurons were nucleofected with 10 µ total DNA plasmid DNA using the AD1 4D-Nucleofector Y kit (Lonza V4YP-1A24) with the ED158 (iCell GlutaNeurons ...
-
bioRxiv - Cell Biology 2023Quote: ... T cells were washed with PBS and resuspended at 100x106 cells/mL in Lonza P3 Primary Cell 4D Nucleofector Kit buffer (Lonza). 1μg/1x106 cells of sgRNA (Agilent ...
-
bioRxiv - Genetics 2023Quote: ... and cells were resuspended according to the protocol provided for the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... The dissociated GSCs (1 × 106 cells) were resuspended in 100 μl of supplemented solution of the Human Stem Cell Nucleofector Kit 1 (Lonza) containing a combination of the px458 plasmid targeting each gene and the ssODN and then electroporated using B-016 program of Nucleofector 2b (Lonza) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-6 million primary human keratinocytes were electroporated with 1 nmol siPools using the Amaxa human keratinocyte Nucleofector kit (Lonza) according to the manufacturer’s instructions and the T-018 program of the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Cancer Biology 2023Quote: Cas9-RNPs were transfected into cells by electroporation (SF Cell Line 4D-Nucleofector™ X Kit S (Lonza, #V4XC-2032)) ...
-
bioRxiv - Microbiology 2023Quote: ... Ribonucleoproteins were introduced into 1 x 106 sub-confluent BLaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Molecular Biology 2023Quote: Transfections of K562 cells were performed using a Lonza Bioscience 4D-Nucleofector system and the SF Cell Line 4D-Nucleofector X kits (Lonza). For single nucleocuvettes (100 uL) ...
-
bioRxiv - Microbiology 2023Quote: ... amazonensis promastigotes using the Human T-Cell Nucleofector kit and the Amaxa Nucleofector electroporator (program U-033, Lonza, Basel, Switzerland), for integration into the 18S rRNA locus within the nuclear DNA ...
-
Efficient Methods for Target Gene Manipulation in Haematopoietic Stem Cell Derived Human NeutrophilsbioRxiv - Cell Biology 2023Quote: ... CD34+ HSPC selected as previously described were preconditioned in SFEM II and StemSpan cytokines for 72 hours and electroporated with the Cas9-gRNP mixture using the Human CD34+ Cell Nucleofector kit (Lonza) in a Lonza IIb Nucleofector using program U-008 ...
-
bioRxiv - Neuroscience 2023Quote: ... before being introduced to the KOLF2 hiPSCs through electroporation (P3 Primary Cell 4D-Nucleofector X Kit, Program CA-137, Lonza). The resulting clones were screened by multiplexed amplicon sequencing on an Illumina Mi-Seq platform with the MiSeq Reagent Kit V2 (Illumina) ...
-
bioRxiv - Bioengineering 2023Quote: Approximately 0.25 × 106 U2OS.eGFP-PEST cells were nucleofected with 300 ng of Cas9 expression plasmid and 30 ng of eGFP-targeting gRNA expression plasmid using the SE Cell line 4D-Nucleofector X Kit (Lonza) and DN100 pulse program ...
-
bioRxiv - Bioengineering 2023Quote: ... and 50 ng of AcrIIA4 expression or 300 ng of Cas9-P2A-CSD-AcrIIIA4 plasmid and 30 ng eGFP-targeting gRNA expression plasmid using the SE Cell line 4D-Nucleofector X Kit (Lonza) and DN100 pulse program ...
-
bioRxiv - Cell Biology 2023Quote: Differentiated HL-60 cells were nucleofected with Amaxa Nucleofector II device and Amaxa Cell line kit V (Lonza, VACA-1003) and prepared for live-cell imaging using aslightly modified version of an existing protocol 96 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Two gRNA plasmids and pCas9 (D10)-GFP plasmid were nucleofected into cells using Basic Nucleofector Kit for Primary Mammalian Epithelial Cells (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... were delivered as a ribonucleoprotein complex with the DNA donor template using a Nucleofector 2b Device and the Human Stem Cell Nucleofector Kit 1 (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were nucleofected with 4 µg of the sgRNA-containing plasmid individually following the Amaxa Mouse ES cell Nucleofector kit recommendations (VPH-1001, Lonza). Later ...
-
bioRxiv - Genetics 2023Quote: LCLs were treated with 2nM Retinoic acid for 24 hours prior to transfection of firefly and renilla luciferase constructs by Amaxa Nucleofector kit V (Lonza) with the X001 program on a Nucleofector II device ...
-
bioRxiv - Cell Biology 2023Quote: ... hESCs were nucleofected with RNPs using the 4D-Nucleofector and P3 Primary Cell 4D-Nucleofector X Kit and program CB150 (Lonza). After 24□hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... and co-transfected with an ssODN donor template containing the desired modification into H9/WA09 cells via nucleofection (Amaxa P3 primary cell 4D nucleofector X kit L, Lonza) using the manufacturer’s recommended protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The cell pellet was used for nucleofection using the P3 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-3024), a 4D-nucleofector core unit and X unit (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: ... serum-starved RPE1 cells where trypsinized and 0.5×106 of the cells were resuspended in 20 μl of the P3 Primary Cell 4D-Nucleofector Kit buffer (Lonza). The cell suspension was then nucleoporated with reporter plasmids with DNA lesions and undamaged control plasmids ...
-
bioRxiv - Cancer Biology 2024Quote: ... and delivered to parental K562 cells by Amaxa nucleofection using the Amaxa Cell line nucleofector kit V (Lonza VCA-1003). GFP+ transfected cells were single-cell sorted into 96-well plates ...
-
bioRxiv - Systems Biology 2024Quote: The reporter cell line for the PTGR screen was created by nucleofection of haploid AN3-12 mESCs with 500ng of the reporter construct and 10 µg of a Tol2 transposase encoding plasmid using the Mouse ES Cell Nucleofector Kit (Lonza) according to the manufacturer’s protocol using an Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... negative selection of T cells was performed using the EasySep human T cell isolation kit (Stemcell) and cultured in X-VIVO 15 medium (Lonza) supplemented with 5% fetal bovine serum (FBS) ...
-
bioRxiv - Biochemistry 2023Quote: ... 100pmol synthetic pegRNA (IDT) and 50pmol sgRNA (IDT) using the P3 primary cell nucleofector kit (cat#V4XP-3032, Lonza Biosciences) and program EH-115 on an Amaxa 4D-Nucleofector ...
-
bioRxiv - Biophysics 2023Quote: ... MCF7 and A375 cells (ATCC) were transfected with 1 μg DNA using the SF Cell Line 4D-Nucleofector kit (Lonza) following the manufacturer’s instructions via electroporation (4D-Nucleofector ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus product was tested to confirm sterility (Mayo Clinic Department of Laboratory Medicine and Pathology) and absence of endotoxin using the LAL-Kinetic QCL Kit (Lonza). Whole genome sequencing was performed by utilizing reverse transcription of purified viral RNA to cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were treated with mycoplasma removal agent (MP Biomedical) and tested monthly for mycoplasma contamination using MycoAlert Plus mycoplasma testing kit (Lonza). SeV Cantell strain was grown in 10-day-old ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were grown at 37℃ and 5% CO2 and were tested for mycoplasma contamination using the MycoAlert PLUS Mycoplasma Testing Kit (Lonza) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... The transfection was carried out by nucleofection using Amaxa® Cell Line Nucleofector Kit V (Program X-001, Lonza, USA). At 24 h after transfection ...
-
bioRxiv - Immunology 2024Quote: ... siRNA against human genes or control siRNA were incubated with a mixture of nucleofection solution (Human Monocytes Nucleofector kit; Lonza) and primary human monocytes and placed in nucleofection cuvettes subjected to program Y-010 for the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected with RNP complex and HDR templates by nucleofection with SF Cell Line 4D-Nucleofector X Kit (Lonza) using 20-ml Nucleocuvette Strips ...
-
bioRxiv - Immunology 2024Quote: ... 5x1e6 cells were transfected with 5μg/plasmid DNA/million cells using a LONZA electroporator (program X-001) and LONZA electroporation kit for primary mouse T cells (VPA-1006; LONZA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: 3×106 of 3-day activated CD8+ T cells were transfected using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 with 1.5/106 ...
-
bioRxiv - Biophysics 2024Quote: ... 0.5 μg of F-tractin-mScarlet plasmid and 0.75 ug of Zyxin-mNeonGreen plasmid were mixed with solution SE from SE Cell Line 4D-Nucleofector S Kits (Lonza). 4×105 cells were mixed with the plasmid-SE solution and nucleofected with program CM-137 using a 4D-Nucleofector (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... nucleofected in a 100 µl reaction using the Lonza 4D-Nucleofector System with P3 Primary Cell 4D-Nucleofector X Kit (Lonza) and program CA137 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg of pHTN HaloTag-CENP-A plasmid was used for transfection performed on Nucleofector Kit R with the Nucleofector 2b Device (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The constructs were then transfected into WT OSCs and Δl(3)mbt-OSCs with Nucleofector Kit V (Lonza, VVCA-1003) using T-029 program and a NucleofectorTM 2b Device (Lonza) ...
-
bioRxiv - Immunology 2024Quote: ... and the GFPSpark and mCherry control vectors (DNA/cell ratio = 1.5 µg/106 cells in single transfections and 1.2 µg/106 cells in co-transfections) by using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 ...
-
bioRxiv - Immunology 2024Quote: For RNAi-mediated TSP-1 and TSP-4 silencing 4×106 3-day activated CD8+ T cells were transfected using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 with 150 pmol/106 cells of human TSP-1 and TSP-4-specific siRNAs (#s14108 and #s14100 ...
-
bioRxiv - Immunology 2024Quote: ... 8×106 CTLs were transfected with 6 µg of plasmid DNA of each construct with P3 Primary Cell 4D-Nucleofector X Kit (Lonza). For the CLEM experiments the cells were transfected with TSP-1-GFPSpark and TSP-4-mCherry ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pCMV-Pbase (0.2µg) (kindly provided by L. Tiberi) using P1 Primary Cell 4D-NucleofectorTM X Kit L (Lonza; V4XP-1024) Amaxa Nucleofector (program FF104 ...