Labshake search
Citations for Lonza :
2551 - 2600 of 2766 citations for Hydrogen Peroxide Fluorescent Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pCMV-Pbase (0.2µg) (kindly provided by L. Tiberi) using P1 Primary Cell 4D-NucleofectorTM X Kit L (Lonza; V4XP-1024) Amaxa Nucleofector (program FF104 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Schizonts were transfected by electroporation using the Lonza 4D Nucleofector System according to the pulse program FI-115 with the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). After transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2×105 cells were electroporated with 250 ng of gRNA plasmids and 750 ng of CBE using the SF Cell Line Nucleofector X Kit (Lonza) via the 4D-Nucleofector system ...
-
bioRxiv - Immunology 2024Quote: ... 5x1e6 cells were transfected with 5μg/plasmid DNA/million cells using a LONZA electroporator (program X-001) and LONZA electroporation kit for primary mouse T cells (VPA-1006; LONZA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: Nucleofection of Jurkat cells was performed using SE Cell Line 4D-Nucleofector™ X Kit L (Lonza, cat. V4XC-1012), while the P3 Primary Cell 4D-Nucleofector™ X Kit L (Lonza ...
-
bioRxiv - Physiology 2024Quote: ... counted and 3.106 cells resuspended in 100 μl Nucleofactor R solution and electroporated with 3 µg of plasmid (pcDNA3 containing or not α7-5HT3 cDNA) using the Amaxa nucleofactor kit R (Lonza) according to the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... and transferred to the well of a 16-well Nucleocuvette™ strip (SF Cell Line 4D-NucleofectorTM X Kit S, Lonza). Cells were electroporated on a 4D-NucleofectorTM X Unit (Lonza ...
-
bioRxiv - Cell Biology 2019Quote: ... Feng and Coulombe 2015b) were transfected into Krt14-/- skin keratinocytes using P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024, Lonza). After nucleofection ...
-
bioRxiv - Cell Biology 2019Quote: ... was transfected into skin keratinocytes in primary culture using the P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024, Lonza).
-
bioRxiv - Cell Biology 2020Quote: Microspheres were tested for LPS contamination using the Limulus Amebocyte Lysate (LAL) QCL-1000™ kit (Lonza Walkersville, Inc., Olten, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... and nucleofected with BioID constructs using an Amaxa Nucleofector II and the Mouse Neural Stem Cell Nucleofector Kit (Lonza; VPG-1004) according the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Neuronal nucleofections were performed immediately before plating at 0 DIV by using an Amaxa Nucleofection Kit (Lonza, Basel, Switzerland, VPG-1003) according to the manufacturer’s optimized protocol (Number 101 ...
-
bioRxiv - Molecular Biology 2020Quote: ... by nucleofection using the Basic Nucleofector Kit for Primary Mammalian Fibroblasts with programme A-24 according to the manufacturer’s instructions (Lonza, Cologne, Germany). Cell clones were isolated after approximately 12 days of puromycin selection (1.5 µg/mL) ...
-
bioRxiv - Cell Biology 2020Quote: BMDMs (1 × 106 cells) were transfected with siRNA (250 pmol) and Amaxa Mouse Macrophage Nucleofector Kit (Lonza, catalog number VPA-1009) using a Lonza Nucleofector 2b device (Lonza ...
-
bioRxiv - Cancer Biology 2020Quote: ... while MCF-10A cells were cultured as per ATCC recommendations in MEGM bullet kit growth media (CC-3150; Lonza, Walkersville, MD) without gentamycin-amphotericin B mix but with additional 100ng/ml cholera toxin (C8052 ...
-
bioRxiv - Cancer Biology 2021Quote: ... in a total volume of 100μL/ reaction and electroporated using an Amaxa TM Basic Nucleofector TM Kit for Primary Mammalian Epithelial cells (Lonza, # VPI-1005) and the NucleofectorTM 2b Device (Lonza ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended with 10µL of primary cell nucleofection solution (P3 primary Cell 4D-Nucleofector X kit S (Lonza, # V4XP-3032), and mixed with RNP complexes ...
-
bioRxiv - Microbiology 2022Quote: ... Residual endotoxins in the purified phage preparations were determined by the Limulus Amebocyte Lysate (LAL) Kinetic-QCL Kit (Lonza, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: mESC were transfected with sgRNA constructs using the P3 Primary Cell 4D-Nucleofector X Kit (V4XP-3024) and the Amaxa 4D Nucleofector™ system (Lonza). We used the transfection programme CG-104 ...
-
bioRxiv - Microbiology 2021Quote: ... The Ala324Thr and the Glu655Asp mutations were independently recreated by transfecting the respective sgRNA template and donor dsDNA using the Basic Parasite Nucleofector™ Kit 1 (Lonza) with the U-033 program following manufacturer recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... DNA electroporation was conducted following the Amanxa® Cell line nucleofector protocol using the Cell Line Nucleofector® Kit R (Lonza). 2 μg plasmid DNA was used per reaction and electroporation was carried out using the I-013 program for high expression efficiency of HeLa cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... Transient transfection of pp150 in HFF was performed by transfecting pp150 expressing plasmid (kindly provided by Edward Mocarski) using Amaxa Nucleofection kit V (Lonza inc.). The pp71-expressing plasmid (pCGN-pp71 ...
-
bioRxiv - Neuroscience 2022Quote: ... cellular ATP content was measured two-three times a week between 5-7.5 weeks post transduction using the ViaLight Plus kit (Lonza, LT07-221) or ATPlite kit (PerkinElmer ...
-
bioRxiv - Immunology 2022Quote: ... were delivered into the CD4+ Human T cells by using Amaxa 4D-Nucleofector System and P2 Primary Cell 4D-Nucleofector® X Kit S (Lonza) according to manufacturer’s instructions using the pulse code EH100 ...
-
bioRxiv - Immunology 2022Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Supplementary Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: ... were transfected with 4 μM of each siRNA (TriFECTa® RNAi Kit, IDT) or negative control siRNA (Universal Negative Control siRNA [Nippon Gene]) by nucleofection (Lonza) using reagent V and the X-001 program ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... E14 cells (5 × 106) were transfected with 10 μg of the appropriate plasmid with the Mouse ES Cell Nucleofector™ Kit (Lonza) and allowed to grow for 48h after transfection ...
-
bioRxiv - Immunology 2019Quote: ... Leishmania tarentolae cells were transfected via electroporation (Nucleofector™ 2b Device, AmaxaTM Human T Cell Nucleofector™ Kit, Lonza, Basel, Switzerland) with the respective expression cassette containing the selective antibiotic marker Nourseothricin (NTC ...
-
bioRxiv - Cell Biology 2019Quote: To induce expression of fluorescently labeled proteins DCs were transfected according to manufacturer guidelines using nucleofector kit for primary T cells (Amaxa, Lonza Group). Briefly ...
-
bioRxiv - Biochemistry 2019Quote: ... 1.5-2×106 cells were pelleted for each condition and resuspended in 100 μL complete nucleofector solution (SE Cell Line 4D-Nucleofector™ X Kit, Lonza) to which 1μg of pCR2.1-mClover-LMNAdonor ...
-
bioRxiv - Neuroscience 2020Quote: ... along with Renilla luciferase control vector using a Human Stem Cell Nucleofector Kit according to the manufacturer’s instructions (Lonza, VPH-5012). Cells were plated in a 96-well plate and terminally differentiated into neurons ...
-
bioRxiv - Cell Biology 2021Quote: ... MDCKII cells were transfected by electroporation with plasmids encoding CD4-SIV Env chimeras using an Amaxa Cell Line Nucleofector™ Kit L and Amaxa Nucleofector II with settings L-05 (Lonza). Stable transfectants were selected with 400 μg/ml G418 Sulphate (Calbiochem) ...
-
bioRxiv - Developmental Biology 2020Quote: ... or a PMO Control at 100 µM in 100 µL solution from the P3 Primary Cell 4D-Nucleofector® X Kit L (V4XP-3024, Lonza) using the CB150 program on the 4D-Nucleofector™ System (Lonza) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell media was collected and the presence of adenylate kinase was measured with the ToxiLightTM cytotoxicity assay kit (Lonza, Basel, Switzerland) to check the integrity of the cell membrane ...
-
bioRxiv - Neuroscience 2019Quote: ... or a non-silencing plasmid immediately before plating (Amaxa™ P3 Primary Cell 4D-Nucleofector X Kit L; Lonza, CU133 program). The generation and knockdown efficiencies of shRNA plasmids were described previously (Guner et al. ...
-
bioRxiv - Immunology 2019Quote: ... Mucin proteins was prepared as previously described45 and confirmed to be endotoxin free using a Limulus Amebocyte Lysate (LAL) assay kit (Lonza, USA). Full details of mucin protein purification and preparation are shown in supplementary methods ...
-
bioRxiv - Genomics 2021Quote: ... K562 cells were grown to a density of 1×106 cells and electroporated with 5μg of plasmid DNA (Amaxa® Cell Line Nucleofector® Kit V, Lonza). Cells from each cell line were cultured for an additional 48 hours until total RNA isolation (Maxwell RSC simplyRNA kit ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and PX458-AAVS1 (3 µg) were electroporated into 1.3×106 H9 cells using the Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012). Following electroporation the cells were seeded across 3-wells of a 6 well plate coated with Matrigel in StemFlex supplemented with RevitaCell supplement (Thermo Fisher ...
-
bioRxiv - Genetics 2021Quote: ... complex and mix of 1:1 ratio WT/mutant donor single-stranded oligodeoxynucleotides carrying PAM mutation by electroporation using Mouse Embryonic Stem Cell Nucleofector™ Kit from Lonza. sgRNA and donor single-stranded oligodeoxynucleotide sequences can be found in supplementary table 5 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 × 106 hiPS cells were nucleofected by Amaxa nuclefector device using Human Stem Cell Nucleofector® Kit 1 (VPH-5012, Lonza) and program B-016 with 4 μg of MyoD plasmid and 1 μg of the dual helper plasmid ...
-
bioRxiv - Immunology 2021Quote: ... were washed in PBS/0.5%BSA and resuspended in 100 µl Nucleofector solution (Amaxa™ P3 Primary Cell 4D Nucleofector TM X Kit L, Lonza) with 4-6 µl of the appropriate siRNA (20-40 µM ...
-
bioRxiv - Genetics 2021Quote: Human K562 cells were nucleofected with already complexed RNP using the SF Cell Line 4D Nucleofector X Kit for Amaxa 4D device (Lonza, Basel) with program FF-120 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RBD-Fc stable clone was obtained by electroporation with 2×106 cells and 5 μg endotoxin-free plasmids using Amaxa kit V and program U24 with Amaxa Nucleofector 2B (Lonza, Switzerland). Electroporated cells were subsequently plated in 96-wells at 500 cells/well in Plating Medium containing 80% EX CELL® CHO Cloning Medium (Cat.no C6366 ...
-
bioRxiv - Neuroscience 2022Quote: Dissociated rat commissural neurons were electroporated with the Amaxa 96-well Shuttle using the P3 Primary Cell 96-well Nucleofector Kit (Lonza, Switzerland). For each electroporation in one well (20 µl ...
-
bioRxiv - Developmental Biology 2022Quote: ... 400,000 H9 cells for each condition were electroporated with 1 μg plasmid via a human stem cell nucleofector™ kit (VPH-5012) by Lonza AMAXA Nucleofector 2B.
-
bioRxiv - Immunology 2022Quote: ... In vitro transcribed mRNAs encoding the TCR α- and β-chains were mixed at a 1:1 ratio and electroporated in activated T cells on a Lonza 4D-NucleofectorTM device using the P3 Primary Cell 4D-Nucleofector™ X Kit (Lonza) according to the recommendations of the manufacturer ...
-
bioRxiv - Physiology 2022Quote: ... 1 million cells were washed with PBS and electroporated with 5-10 μg of appropriate plasmid using Amaxa cell nucleofector kit T (Lonza laboratories). Cells were allowed to recover for 48 h ...