Labshake search
Citations for Lonza :
2251 - 2300 of 2766 citations for Hydrogen Peroxide Fluorescent Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Cultures were kept mycoplasma free and mycoplasma contaminations were monitored weekly using the Mycoalert Luminescence Kit (Lonza).
-
bioRxiv - Molecular Biology 2023Quote: A Lonza Nucleofector system including a Nucleofector 2b Device and the Cell Line Nucleofector Kit V (Lonza) were used for electroporation of LbuCas13a protein and guide RNA ...
-
bioRxiv - Microbiology 2023Quote: siRNAs targeting bovine hnRNPM were introduced into BL3.1 cells using Amaxa cell line Nucleofector kit V (Lonza) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Electroporation of the RNP complex was carried out using the SF Cell Line 4D-Nucleofector kit (Lonza) and program CM-130 with 2.0×105 cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... following the protocol of 4D-Nucleofector™ Solution (SE Cell Line 4D-Nucleofector™ X Kit, Lonza). In this setup ...
-
bioRxiv - Bioengineering 2023Quote: ... 1×106 cells were nucleofected using the Lonza SF Cell Line 4D-Nucleofector Kit (Lonza V4XC-2012) and a Lonza 4D Nucleofector (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the P3 Primary Cell 4D-Nucleofector X Kit for Amaxa 4-D device (Lonza, #V4XP-3032). 2×10E5 cells per condition were nucleofected in separated strip wells using program EO-100 ...
-
bioRxiv - Cell Biology 2023Quote: ... and these cells were transferred to a cuvette (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) for nucleofection in a 4D-Nucleofector (Lonza ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the CRISPR/Cas9 system and the P3 Primary Cell 4D-Nucleofector X Kit L (Lonza, Switzerland). Oligonucleotides for gRNA were selected by Сrispor (Tefor Infrastructure ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were transfected by nucleofection using the Lonza Cell line Nucleofector Kit V (Lonza, Basel, Switzerland, #VVCA1003) and the Amaxa Nucleofector II device ...
-
bioRxiv - Bioengineering 2023Quote: Nucleofection in T cells were performed using P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza) according to the manufacturer’s instruction with minor modifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were confirmed negative for mycoplasma contamination using the MycoAlert PLUS kit (Lonza, #LT07–710). Non-targeting control (NT CT) ...
-
The spindle protein CKAP2 regulates microtubule dynamics and ensures faithful chromosome segregationbioRxiv - Cell Biology 2023Quote: ... cells were transfected using Nucleofection with an Amaxa SF Cell Line 4D-Nucleofector X kit S (Lonza) and program FF-113 (HT1080 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 million cells were resuspended in 100 mL of the AmaxaTM NHDF Nucleofector kit (Lonza, Walkersville, MD), containing 1ug of each of the four episomal plasmid vectors encoding OCT3/4 and p53 shRNA ...
-
bioRxiv - Genetics 2024Quote: ... was transfected into 1 million GMSM-K with Amaxa Cell Line Nucleofector Kit V (Lonza, Cologne, Germany) using Nucleofector II (Lonza ...
-
bioRxiv - Immunology 2024Quote: ... All cell lines were routinely tested for mycoplasma with the MycoAlert Mycoplasma test kit (Lonza, Basel, Switzerland).
-
bioRxiv - Molecular Biology 2024Quote: ... Paired guide RNPs were mixed with nucleofection buffer (SF Cell Line 4D X Kit, Lonza, #V4XC-2024) and delivered into 10 million vAbl cells using 4D-nucleofector system (Lonza ...
-
bioRxiv - Neuroscience 2024Quote: ... Nucleofection was performed using the P3 Primary Cell 4D-NucleofectorTMX Kit L (Lonza, catalogue no. V4XP-3032), a 4D-nucleofector core unit and the X unit (Lonza ...
-
bioRxiv - Molecular Biology 2021Quote: ... and transfected using the Lonza Amaxa® Cell Line Nucleofector® Kit V (Lonza, Basel, Switzerland VCA-1003) using electroporation program A30 ...
-
bioRxiv - Molecular Biology 2020Quote: ... This vector and the piggy bac transposase were then nucleofected into H9 using the AMAXA nucleofector kit (Lonza). Puromycin selection started 4 days following nucleofection and the surviving clones were screened by qPCR and Western Blot for NSUN6 expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... All lines were validated by STR analysis yearly and checked for mycoplasma contamination using MycoAlert PLUS kit (Lonza). Conditioned medium was collected by starving sub-confluent cells for 24 h in α-MEM (Gibco).
-
bioRxiv - Microbiology 2019Quote: ... All POLIC variant expression constructs (15 µg) were transfected by nucleofection using the Amaxa Nucleofection Parasite Kit (Lonza) into 29-13 cells to generate inducible overexpression POLIC-PTP variant cell lines (OE ...
-
bioRxiv - Immunology 2019Quote: ... gRNA and Cas9 containing plasmids were introduced to prostate epithelial cells using the basic nucleofector kit (Amaxa, Lonza) following the manufacturer’s instructions for primary mammalian epithelial cells (program W001) ...
-
bioRxiv - Immunology 2021Quote: ... The P14 cell/Cas9/RNP mixes were transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... The presence of mycoplasma was tested for frequently in all cell lines with a MycoAlert kit (Lonza, Switzerland), exclusively using mycoplasma-free cells in all the experiments carried out.
-
Interactions with stromal cells promote a more oxidized cancer cell redox state in pancreatic tumorsbioRxiv - Cancer Biology 2020Quote: ... PDAC cells grown as 3D organoids were regularly tested for mycoplasma contamination using the MycoAlert Plus kit (Lonza) or the Mycoprobe Mycoplasma Detection Kit (R&D Systems).
-
bioRxiv - Neuroscience 2022Quote: ... 5 × 106 trypsinized cells were resuspended in 93.5 µl solution (mouse ES cell nucleofector kit, VPH-1001, Lonza). The solution includes 2 µg of each CRISPR/Cas9 vector (4 µg total ...
-
bioRxiv - Immunology 2020Quote: ... 1×106 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
bioRxiv - Microbiology 2020Quote: Electroporation was performed using the Amaxa P3 Primary Cell 96-well Nucleofector kit and 4D Nucleofector system (Lonza). Recombinant S ...
-
bioRxiv - Neuroscience 2021Quote: ... freshly isolated cortical neurons were transfected using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, LZ-V4XP-3024) and the program DC-104 of the 4D-Nucleofector device (Lonza) ...
-
bioRxiv - Cell Biology 2021Quote: ... RNP was delivered by electroporation using a Lonza 4D-nucleofector and P3 Primary Cell Kit (Lonza, V4XP-3012). Cells were transferred to fresh StemSpan media and corresponding (AK2 or AAVS1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... A human breast MCF10A cell line (CRL10317, ATCC) was grown with completed growth medium: MEGM Kit (Lonza CC3150) without gentamycin-amphotericin B mix (GA1000 ...
-
bioRxiv - Genetics 2022Quote: ... were cultured in RtEGM with supplement medium as indicated by the manufacturer’s protocol (RtEGM bullet kit, Lonza, #00195409). HfRPE cells were cultured to high confluence on coverglass culture plates (Thermo ...
-
bioRxiv - Immunology 2022Quote: ... 1 x 10^6 purified naive T-cells were resuspended in 15µL buffer P3 + 5µL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7µL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Cell Biology 2019Quote: Stably transfected U2OS cells were generated using using Cell Line Nucleofector Kit V and a Nucleofector electroporator (Lonza). After 24 hours ...
-
bioRxiv - Pathology 2020Quote: ... Plasmid delivery through electroporation of passage three neurospheres was performed using Mouse neural stem cell nucleofector kit (Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... H2228 cells were electroporated with 3ug DRGFP substrate using reagent T (Amaxa Cell Line Nucleofector Kit T, Lonza), program X-001 on the Nucleofector 2b (Lonza) ...
-
bioRxiv - Microbiology 2020Quote: ... 1 million Jurkat T-cells were resuspended in 100 μL Nucleofector solution (Cell Line Nucleofector™ Kits, Lonza) and combined with 2 μg of the linearized dual-fluorophore vector and 2 μg of the corresponding gRNA/Cas9 plasmid ...
-
bioRxiv - Genomics 2021Quote: ... K562 cells were grown to 1×106 and transfected with 1,000ng of gRNA plasmid and 3,000 ng of pCMV_AncBE4max_P2A_GFP (Amaxa® Cell Line Nucleofector® Kit V, Lonza). K562 cells were cultured for an additional 48 hours then single clones of green cells were isolated using flow cytometry (Aria II) ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the Cell Line Nucelofector Kit V and the Amaxa Nucleofector II Device (Lonza Group AG, Basel, CH). Stable cells were selected for with 1mg/mL hygromycin B (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: A human breast MCF10A cell line (CRL10317, ATCC) was grown with completed growth medium: MEGM Kit (Lonza CC3150) without gentamycin-amphotericin B mix (GA1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... fixed after 12 days and stained according to the OsteoImage™ Mineralisation Assay Lonza kit (PA-1503, Lonza) protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... EB3-mCherry construct (Stepanova et al., 2003) was transiently transfected using Amaxa Cell Line Nucleofector kit V (Lonza), program X-001.
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were regularly tested for mycoplasma contamination using a biochemical test kit (#LT07-318, Lonza, Switzerland) and were free of mycoplasma contamination.
-
bioRxiv - Cell Biology 2022Quote: ... 25 μg mRNA was transfected into 2.5 × 106 freshly thawed fibroblasts using Cell Line Nucleofector Kit V (Lonza) and AMAXA program X-001 following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of these dominant-negative Rab11 a and siRab11 a into mouse MΦs (RAW 264.7 cell line) were performed with Amaxa mouse macrophage nucleofector kit (VPA-1009, Lonza) and DharmaFECT 4 Transfection Reagent (T-2004-01 ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kits (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... we used the 4D-Nucleofector system and Amaxa P3 primary Cell 4D-Nucleofector X Kit S from Lonza. The electroporation buffer used was P3 primary cell Nucleofector Solution with Supplement 1 (Lonza) ...
-
bioRxiv - Immunology 2024Quote: ... 1 - 2.5 × 106 Jurkat T cells were resuspended in EP buffer from the Nucleofector® Kit V (Lonza). Cells were combined with 1.5 μg of donor plasmid in a reaction volume of 100 μL and electroporated on the Amaxa® Nucleofector® II using pulse code X-005.