Labshake search
Citations for Lonza :
2451 - 2500 of 2592 citations for Human Hepcidin Hepc CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... All parasite strains and host cell lines were routinely tested for Mycoplasma contamination with the MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland) and found to be negative.
-
bioRxiv - Genomics 2021Quote: ... All the cells were grown with 5% CO2 at 37°C and verified mycoplasma free using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218).
-
bioRxiv - Molecular Biology 2020Quote: pSBbi-Pur-ABCC1 or empty vector were cotransfected with SB100X using the same Amaxa Nucleofector II and kit V (Lonza Group AG). Stably expressing cells were selected for using 10ug/mL puromycin (Gibco) ...
-
bioRxiv - Biophysics 2021Quote: ... All cell lines were regularly tested for mycoplasma infection and were found to be negative (MycoAlert Plus Detection Kit, Lonza, LT07-710).
-
bioRxiv - Immunology 2021Quote: ... gRNA_pX335 plasmids were transfected into EL4 cells by nucleofection using an Amaxa nucleofector and the Cell Line Nucleofector Kit L (Lonza, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 2 million L1.2 cells were transfected with 2 µg of plasmid using the SG Cell Line transfection kit and a 4D-Nucleofector X (both from Lonza, Walkersville, MD) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... All cell lines were routinely tested to confirm absence of mycoplasma using the MycoAlert Plus Mycoplasma Detection Kit from Lonza (Walkersville, MD).
-
bioRxiv - Genomics 2021Quote: ... transfection of primary T cells with Cas9 RNP complexes and GSH1/GSH2-mRuby HDR templates was performed using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... dissociated ganglia were pelleted at 100 x g for 5 min and resuspended in 100 µl ‘Nucleofector solution’ (Rat Neuron Nucleofector kit; Lonza, Alpharetta, GA). 4-6 μg of plasmid was electroporated using the AMAXA Nucleofector device (Neurons Rat DRG ...
-
bioRxiv - Neuroscience 2020Quote: ... Single iPSCs were then nucleofected with the pX459v2 plasmid coding for the Cas9 protein and the sgRNA using P3 primary Cell 4D nucleofector kit (Lonza, V4XP-302). After nucleofection cells were plated on a 6-well plate in E8 flex medium supplemented with RevitaCell ...
-
bioRxiv - Developmental Biology 2022Quote: ... D-001206-14-05 5 nmol) and nucleofected into OPCs using the Basic Nucleofector Kit for Primary Mammalian Glial Cells (Lonza, VPI-1006) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were co-transfected with 1 ug of firefly Luciferase vector and 0.1 ug Renilla luciferase vector by nucleofection with Lonza Cell Line Nucleofector® Kit V (Lonza, #VVCA-1003) and the T-020 program in the Amaxa Nucleofector II device ...
-
bioRxiv - Bioengineering 2022Quote: Cell cultures were monitored for the presence of mycoplasma contamination using the MycoAlert® Mycoplasma Detection Kit (Lonza #LT07-318, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Normal bronchial epithelial cells (BEAS-2B / ATCC-CRL-9609) were cultured in collagen coated flasks using the bronchial epithelial growth medium supplemented with Lonza Bullet Kit (BEGM, Lonza CC-3170), as described by ATCC culture instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The plasmids were co-transfected into H9 hESC cells using the Amaxa 4D nucleofector (#AAF-1003B and #AAF-1003X) and the P3 Primary Cell 4D-Nucleofector X kit (Lonza, #V4XP-3024).
-
bioRxiv - Molecular Biology 2022Quote: ... using nucleofection with the Amaxa 4D-Nucleofector X-Unit and the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, V4XP-3024 KT). 2×106 cells were harvested using accutase (Sigma Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... pre-coated cell culture 6-well plate with EBM-2 endothelial media supplemented with 10% FBS and a growth factor bullet kit (Lonza, Walkersville, USA) 3 mL/well ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were authenticated by STR testing upon receipt and were routinely tested and verified as mycoplasma negative using the MycoAlert kit (Lonza, Cambridge, MA). Human recombinant TNF was purchased from BioLegend Inc (San Diego ...
-
bioRxiv - Molecular Biology 2022Quote: ... HEK293T cells used in this study were confirmed to be negative for Mycoplasma Contamination and routinely tested using the MycoAlertTM Mycoplasma Detection Kit (Lonza, LT07-418). For experiments involving the SMAD4 gene ...
-
bioRxiv - Synthetic Biology 2022Quote: ... human aortic endothelial cells (CD31+) from were maintained in EGM™-2 Endothelial Cell Growth Medium-2 Bullet Kit™ (Cat # CC-3162; Lonza) and EGM™ −2 MV Microvascular Endothelial Cell Growth Medium-2 Bullet KitTM (Cat #CC-3202 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The culture medium or the DNA harvested from the cultures were tested for mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza, LT07-418) or e-Myco PLUS PCR Detection Kit (BOCA scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were routinely confirmed to be mycoplasma free by using the MycoAlert Mycoplasma Detection kit (Lonza, cat no LT07-318). SB1690CB was a gift of Stefan Meyer (18).
-
bioRxiv - Cancer Biology 2024Quote: ... CRISPR-CAS9 knockout in SU-DIPGXIII cells was performed using the Amaxa P3 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-3012). First ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cell lines were routinely monitored to ensure the absence of Mycoplasma contamination using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza #LT07-705).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and the cell pellet was resuspended in Keratinocyte Growth Medium-2 Bullet Kit (KGM2 medium) consisting of KGM-2 Basal Medium and KGM-2 SingleQuots Supplements (Lonza, Basel, Switzerland), and then seeded onto Petri dishes coated with collagen IV ...
-
bioRxiv - Synthetic Biology 2024Quote: Electroporation was done 7 days after stimulation by DynaBeads using a P3 Primary Cell 4D-Nucleofector™ X Kit (Lonza #V4XP-3012). 750 ng of HDR template was mixed with 50 pmol of RNP and incubated at room temperature for 10 minutes ...
-
bioRxiv - Genomics 2024Quote: ... and electroporated with 6 μg of gRNA-Cas9 expression vector and 3 μg of SNRPN targeting vector using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3032). Transfected cells were plated into a 10 cm dish coated with Matrigel (Corning ...
-
bioRxiv - Genomics 2024Quote: ... were complexed for 20 minutes at room temperature and were nucleofected into 5E5 PEmax parental cells using the SE Cell Line 4D-Nucleofector X Kit (Lonza V4XC-1032) and program FF-120 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were resuspended in 20 µl nucleofection buffer (16.4 µl Nucleofector® Solution + 3.6 µl Supplement) provided in P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza, V4XP-3032). After the addition of 3 µl RNP and 0.5 µl of Alt-R Cas9 Electroporation Enhancer (IDT ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... All cell lines were tested and negative for mycoplasma contamination by staff at the Mycoplasma Testing Facility (UNSW Sydney, Sydney, Australia) using the MycoAlertTM Mycoplasma Detection Kit (Lonza, Basel, Switzerland) every three months.
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 humidity and were tested routinely for mycoplasma using MycoAlert mycoplasma detection kit (Lonza, LT07-318) and appropriate positive control (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell lines were cultured in a humidified incubator at 37°C and 5% CO2 and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Genetics 2023Quote: ... The media was removed from the cell pellet and cells were resuspended according to the protocol provided for the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024). Briefly ...
-
bioRxiv - Genomics 2023Quote: ... 200,000 cells were nucleofected with 50 fmol transposon and 50 fmol transposase (Super piggyBac Transposase - SystemBio PB210PA-1) or with 300 ng pmaxGFP using the P2 Primary Cell 4D Nucleofector kit (Lonza V4SP-2096) and the Lonza 4D- Nucleofector with the DS-150 program ...
-
bioRxiv - Neuroscience 2023Quote: ... All cell lines used in this study were tested mycoplasma free by first culturing the cells for 3-5 days in antibiotic-free media and then subjected to a mycoplasma tested using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, UK).
-
bioRxiv - Cell Biology 2023Quote: ... All cells were cultured at 37 °C and 5% CO2 in a humidified incubator and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Immunology 2022Quote: LPS concentration in serum was determined using a chromogenic assay based on a Limulus amebocyte extract (LAL kit-terminal QCL1000) (LONZA, Basel, Switzerland). Samples were collected at the time of euthanasia via cardiac puncture to try to minimize as much as possible the chance of contamination ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... ePB master vector and helper (Plasmid AW-27) were nucleofected into the established SOX2::mCitrine cell line using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012). G-418 (40ng/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells used in this study were negatively tested for mycoplasma contamination using MycoAlert™ Mycoplasma Detection Kit (LT07-118, Lonza, Switzerland).
-
bioRxiv - Genomics 2023Quote: ... All cells were cultured with 5% CO2 at 37°C and verified to be free of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218). Wild type MCF7 cells were a gift from Howard Y ...
-
bioRxiv - Genomics 2023Quote: ... was mixed with 16.4 μL Nucleofector SolutionTM and 3.6 μL Supplement and incubated at room temperature for about 10 min according to the instruction of Amaxa 4D-Nucleofector X Kit TM (Lonza, #V4XP-3032). HepG2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 100,000 MCF10a cells was nucleofected with program DS-138 using an Amaxa 4D-Nucleofector X using the SE Cell Line 4D X Kit S 32 RCT (Lonza V4XC-1032). Reactions were split between two 24-well plates and grown in complete media three days ...
-
bioRxiv - Microbiology 2023Quote: ... with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Guides targeting CCNT1 were complexed with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were routinely confirmed to be negative for mycoplasma by testing with a MycoAlert Mycoplasma Detection Kit (Lonza # LT07-701).
-
bioRxiv - Bioengineering 2023Quote: ... were cultured in Endothelial Cell Basal Medium (EBM) supplemented with the Endothelial Growth Media kit (EGM-2) (CC-3162, Lonza, Basel, Switzerland). All cells were maintained at 37°C and 5% CO2 and used between passage number 3-7 ...
-
bioRxiv - Microbiology 2023Quote: ... cells then were electroporated using electroporation code EH-100 and using the P3 Primary Cell 96-well Nucleofector Kit (Lonza, V4SP-3096). Knockout pools were maintained for an additional nine days prior to coculturing with H80 feeder cell line with IL-2 (Final conc 20 U/mL ...
-
bioRxiv - Immunology 2023Quote: ... Purified templates together with 2 µg of LentiGuide-Gbp-Chr3-sg3+sg4 were electroporated into RAW-Cas9 cells using Lonza SF cell line X kit (Lonza, V4XC-2012) on a Lonza 4D-Nucleofector unit (Lonza) ...