Labshake search
Citations for Lonza :
2301 - 2350 of 2592 citations for Human Hepcidin Hepc CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2×105 cells were electroporated with 250 ng of gRNA plasmids and 750 ng of CBE using the SF Cell Line Nucleofector X Kit (Lonza) via the 4D-Nucleofector system ...
-
bioRxiv - Molecular Biology 2024Quote: ... Schizonts were transfected by electroporation using the Lonza 4D Nucleofector System according to the pulse program FI-115 with the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). After transfection ...
-
bioRxiv - Immunology 2024Quote: Nucleofection of Jurkat cells was performed using SE Cell Line 4D-Nucleofector™ X Kit L (Lonza, cat. V4XC-1012), while the P3 Primary Cell 4D-Nucleofector™ X Kit L (Lonza ...
-
bioRxiv - Microbiology 2024Quote: ... Full mature schizonts were purified from highly synchronized parasites and then transfected with pFCEN-rif plasmids with a Amaxa nucleofector 2 with parasite nucleofector kit 2 (LONZA). Since the pFCEN-rif has the human dihydrofolate reductase as a drug selectable marker ...
-
bioRxiv - Physiology 2024Quote: ... counted and 3.106 cells resuspended in 100 μl Nucleofactor R solution and electroporated with 3 µg of plasmid (pcDNA3 containing or not α7-5HT3 cDNA) using the Amaxa nucleofactor kit R (Lonza) according to the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mycoplasma detection was routinely performed to ensure cells were not infected with mycoplasma by using MycoAlert Detection kit (Lonza, LT07-218). Cells were maintained at 37°C in a 5% CO2 incubator ...
-
bioRxiv - Cancer Biology 2021Quote: ... and transferred to the well of a 16-well Nucleocuvette™ strip (SF Cell Line 4D-NucleofectorTM X Kit S, Lonza). Cells were electroporated on a 4D-NucleofectorTM X Unit (Lonza ...
-
bioRxiv - Cell Biology 2019Quote: ... Feng and Coulombe 2015b) were transfected into Krt14-/- skin keratinocytes using P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024, Lonza). After nucleofection ...
-
bioRxiv - Cell Biology 2019Quote: ... was transfected into skin keratinocytes in primary culture using the P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024, Lonza).
-
bioRxiv - Cell Biology 2020Quote: Microspheres were tested for LPS contamination using the Limulus Amebocyte Lysate (LAL) QCL-1000™ kit (Lonza Walkersville, Inc., Olten, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were tested for mycoplasma on receipt of the cell line and quarterly thereafter using the MycoAlert Mycoplasma Detection Kit according to the manufacturer’s instructions (Lonza, Basel, Switzerland).
-
bioRxiv - Immunology 2021Quote: ... All generated THP1 and iMAC clones were tested negative for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (Lonza, Cat#LT07-318). THP1 cells were obtained from ATCC ...
-
bioRxiv - Developmental Biology 2020Quote: ... and nucleofected with BioID constructs using an Amaxa Nucleofector II and the Mouse Neural Stem Cell Nucleofector Kit (Lonza; VPG-1004) according the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: CRISPR plasmid constructs (2 μg) were electroporated into 2 × 106 Raji cells using the Amaxa Cell Line Nucleofector Kit V (Lonza Bioscience) (Program M-013) ...
-
bioRxiv - Neuroscience 2021Quote: ... Neuronal nucleofections were performed immediately before plating at 0 DIV by using an Amaxa Nucleofection Kit (Lonza, Basel, Switzerland, VPG-1003) according to the manufacturer’s optimized protocol (Number 101 ...
-
bioRxiv - Molecular Biology 2020Quote: ... by nucleofection using the Basic Nucleofector Kit for Primary Mammalian Fibroblasts with programme A-24 according to the manufacturer’s instructions (Lonza, Cologne, Germany). Cell clones were isolated after approximately 12 days of puromycin selection (1.5 µg/mL) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and ECs from healthy donor and patients were cultured in EGM-2 (EBM-2 + SingleQuots™ Kit) and 2% Foetal Bovine Serum (FBS) (Lonza). HUVECs and ECs were used between P2 and P6 passage ...
-
bioRxiv - Cell Biology 2020Quote: BMDMs (1 × 106 cells) were transfected with siRNA (250 pmol) and Amaxa Mouse Macrophage Nucleofector Kit (Lonza, catalog number VPA-1009) using a Lonza Nucleofector 2b device (Lonza ...
-
bioRxiv - Biophysics 2019Quote: ... Our working stock tested negative for mycoplasma contamination using the MycoAlert® Mycoplasma Detection Kit (Lonza Bioscience; Burton on Trent, UK). For experiments ...
-
bioRxiv - Microbiology 2021Quote: ... pcDNA3-JUP or empty vector were transfected into Caco-2 cells using SE Cell Line 4D-Nucleofector™ X Kit (Lonza) and an Amaxa 4D Nucleofector device from Lonza ...
-
bioRxiv - Genomics 2021Quote: ... Cell lines were authenticated by STR profiling and mycoplasma testing was performed using the MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza). U2OS cells were grown in DMEM supplemented with 10% tetracycline-free foetal bovine serum (Clontech) ...
-
bioRxiv - Neuroscience 2020Quote: ... All cells were routinely tested for mycoplasma contamination with MycoAlert Mycoplasma Detection Kit (Lonza, Rockland, ME, USA, Cat N° LT07-318). Chemicals and cell culture reagents were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cancer Biology 2020Quote: ... while MCF-10A cells were cultured as per ATCC recommendations in MEGM bullet kit growth media (CC-3150; Lonza, Walkersville, MD) without gentamycin-amphotericin B mix but with additional 100ng/ml cholera toxin (C8052 ...
-
bioRxiv - Cell Biology 2021Quote: Cell lines were cultured according to standard aseptic mammalian tissue culture protocols in 5% CO2 at 37 °C with regular testing for mycoplasma contamination using the MycoAlert™ Mycoplasma Detection Kit (Lonza). HCT 116 ...
-
Rag GTPases and Phosphatidylinositol 3-Phosphate Mediate Recruitment of the AP-5/SPG11/SPG15 ComplexbioRxiv - Cell Biology 2020Quote: ... The cell lines were routinely tested for the presence of mycoplasma contamination using MycoAlert™ Mycoplasma Detection Kit (LT07-318, Lonza), and were also regularly treated with mycoplasma removing agent (093050044 ...
-
bioRxiv - Cancer Biology 2021Quote: ... in a total volume of 100μL/ reaction and electroporated using an Amaxa TM Basic Nucleofector TM Kit for Primary Mammalian Epithelial cells (Lonza, # VPI-1005) and the NucleofectorTM 2b Device (Lonza ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended with 10µL of primary cell nucleofection solution (P3 primary Cell 4D-Nucleofector X kit S (Lonza, # V4XP-3032), and mixed with RNP complexes ...
-
bioRxiv - Developmental Biology 2022Quote: ... and all cell lines are routinely monitored for mycoplasma infection monthly using the MycoAlert Mycoplasma Detection Kit (Lonza, Cat#LT08-118). Stem cells were maintained as previously described (Spence et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Residual endotoxins in the purified phage preparations were determined by the Limulus Amebocyte Lysate (LAL) Kinetic-QCL Kit (Lonza, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were negative for mycoplasma contamination and are regularly tested using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza, Rockville, MD, USA). Unless stated otherwise ...
-
bioRxiv - Genomics 2022Quote: mESC were transfected with sgRNA constructs using the P3 Primary Cell 4D-Nucleofector X Kit (V4XP-3024) and the Amaxa 4D Nucleofector™ system (Lonza). We used the transfection programme CG-104 ...
-
bioRxiv - Bioengineering 2022Quote: ... the basal channels of the Intestine Chips were first rinsed with endothelial cell culture medium consisting of stem cell medium supplemented with components from EGM™-2 MV Microvascular Endothelial SingleQuots Kit (CC-4147; Lonza), and then 50 μL HIMECS (450,000 cells/chip ...
-
bioRxiv - Microbiology 2021Quote: ... HPMEC were cultured in endothelial cell growth basal medium 2 supplemented with an Endothelial Cell Growth Medium-2 (EGM-2™) supplemental bullet kit (Lonza). Cells were maintained at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2021Quote: ... The Ala324Thr and the Glu655Asp mutations were independently recreated by transfecting the respective sgRNA template and donor dsDNA using the Basic Parasite Nucleofector™ Kit 1 (Lonza) with the U-033 program following manufacturer recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... DNA electroporation was conducted following the Amanxa® Cell line nucleofector protocol using the Cell Line Nucleofector® Kit R (Lonza). 2 μg plasmid DNA was used per reaction and electroporation was carried out using the I-013 program for high expression efficiency of HeLa cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... Transient transfection of pp150 in HFF was performed by transfecting pp150 expressing plasmid (kindly provided by Edward Mocarski) using Amaxa Nucleofection kit V (Lonza inc.). The pp71-expressing plasmid (pCGN-pp71 ...
-
bioRxiv - Neuroscience 2022Quote: ... cellular ATP content was measured two-three times a week between 5-7.5 weeks post transduction using the ViaLight Plus kit (Lonza, LT07-221) or ATPlite kit (PerkinElmer ...
-
bioRxiv - Cell Biology 2022Quote: ... were transfected with 4 μM of each siRNA (TriFECTa® RNAi Kit, IDT) or negative control siRNA (Universal Negative Control siRNA [Nippon Gene]) by nucleofection (Lonza) using reagent V and the X-001 program ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... E14 cells (5 × 106) were transfected with 10 μg of the appropriate plasmid with the Mouse ES Cell Nucleofector™ Kit (Lonza) and allowed to grow for 48h after transfection ...
-
bioRxiv - Biophysics 2020Quote: ... All the primary GBM cell lines were checked periodically for mycoplasma contamination using the MycoAlertTM Mycoplasma Detection Kit (Lonza, Basel, Switzerland). All Patient-derived biological samples were collected according to a protocol approved by Italian Local Ethics Committee (CE IRST IRCCS-AVR ...
-
bioRxiv - Cell Biology 2019Quote: To induce expression of fluorescently labeled proteins DCs were transfected according to manufacturer guidelines using nucleofector kit for primary T cells (Amaxa, Lonza Group). Briefly ...
-
bioRxiv - Biochemistry 2019Quote: ... 1.5-2×106 cells were pelleted for each condition and resuspended in 100 μL complete nucleofector solution (SE Cell Line 4D-Nucleofector™ X Kit, Lonza) to which 1μg of pCR2.1-mClover-LMNAdonor ...
-
bioRxiv - Cell Biology 2021Quote: ... MDCKII cells were transfected by electroporation with plasmids encoding CD4-SIV Env chimeras using an Amaxa Cell Line Nucleofector™ Kit L and Amaxa Nucleofector II with settings L-05 (Lonza). Stable transfectants were selected with 400 μg/ml G418 Sulphate (Calbiochem) ...
-
bioRxiv - Cell Biology 2021Quote: ... All cell lines used in this study were monitored for mycoplasma infection using the MycoAlert Mycoplasma Detection Kit (Lonza TL07-218).
-
bioRxiv - Developmental Biology 2020Quote: ... or a PMO Control at 100 µM in 100 µL solution from the P3 Primary Cell 4D-Nucleofector® X Kit L (V4XP-3024, Lonza) using the CB150 program on the 4D-Nucleofector™ System (Lonza) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell media was collected and the presence of adenylate kinase was measured with the ToxiLightTM cytotoxicity assay kit (Lonza, Basel, Switzerland) to check the integrity of the cell membrane ...
-
bioRxiv - Neuroscience 2019Quote: ... or a non-silencing plasmid immediately before plating (Amaxa™ P3 Primary Cell 4D-Nucleofector X Kit L; Lonza, CU133 program). The generation and knockdown efficiencies of shRNA plasmids were described previously (Guner et al. ...