Labshake search
Citations for Lonza :
2201 - 2250 of 2572 citations for PGFM ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... All cell lines used in this study were tested mycoplasma free by first culturing the cells for 3-5 days in antibiotic-free media and then subjected to a mycoplasma tested using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, UK).
-
bioRxiv - Cell Biology 2023Quote: ... All cells were cultured at 37 °C and 5% CO2 in a humidified incubator and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Immunology 2022Quote: LPS concentration in serum was determined using a chromogenic assay based on a Limulus amebocyte extract (LAL kit-terminal QCL1000) (LONZA, Basel, Switzerland). Samples were collected at the time of euthanasia via cardiac puncture to try to minimize as much as possible the chance of contamination ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... ePB master vector and helper (Plasmid AW-27) were nucleofected into the established SOX2::mCitrine cell line using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012). G-418 (40ng/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells used in this study were negatively tested for mycoplasma contamination using MycoAlert™ Mycoplasma Detection Kit (LT07-118, Lonza, Switzerland).
-
bioRxiv - Genomics 2023Quote: ... All cells were cultured with 5% CO2 at 37°C and verified to be free of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218). Wild type MCF7 cells were a gift from Howard Y ...
-
bioRxiv - Genomics 2023Quote: ... was mixed with 16.4 μL Nucleofector SolutionTM and 3.6 μL Supplement and incubated at room temperature for about 10 min according to the instruction of Amaxa 4D-Nucleofector X Kit TM (Lonza, #V4XP-3032). HepG2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 100,000 MCF10a cells was nucleofected with program DS-138 using an Amaxa 4D-Nucleofector X using the SE Cell Line 4D X Kit S 32 RCT (Lonza V4XC-1032). Reactions were split between two 24-well plates and grown in complete media three days ...
-
bioRxiv - Microbiology 2023Quote: ... with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Guides targeting CCNT1 were complexed with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were routinely confirmed to be negative for mycoplasma by testing with a MycoAlert Mycoplasma Detection Kit (Lonza # LT07-701).
-
bioRxiv - Bioengineering 2023Quote: ... were cultured in Endothelial Cell Basal Medium (EBM) supplemented with the Endothelial Growth Media kit (EGM-2) (CC-3162, Lonza, Basel, Switzerland). All cells were maintained at 37°C and 5% CO2 and used between passage number 3-7 ...
-
bioRxiv - Microbiology 2023Quote: ... cells then were electroporated using electroporation code EH-100 and using the P3 Primary Cell 96-well Nucleofector Kit (Lonza, V4SP-3096). Knockout pools were maintained for an additional nine days prior to coculturing with H80 feeder cell line with IL-2 (Final conc 20 U/mL ...
-
bioRxiv - Immunology 2023Quote: ... Purified templates together with 2 µg of LentiGuide-Gbp-Chr3-sg3+sg4 were electroporated into RAW-Cas9 cells using Lonza SF cell line X kit (Lonza, V4XC-2012) on a Lonza 4D-Nucleofector unit (Lonza) ...
-
bioRxiv - Cancer Biology 2022Quote: ... All human cell lines were authenticated by STR analysis at the JCRB Cell Bank and tested for Mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines used in this study tested negative for Mycoplasma contamination via MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Cell Biology 2023Quote: PMOs were dissolved in distilled water and transfected into RD cells using the Amaxa Cell Line Nucleofector Kit L and a Nucleofector II electroporation device (Lonza, Basel, Switzerland) with program T-030 or into cells from a DMD patient without a transfection reagent.
-
bioRxiv - Cell Biology 2023Quote: ... The linearized construct and the purified schizonts were mixed with Nucleofector solution from an Amaxa human T cell Nucleofector Kit and electroporated using the Amaxa Nucleofector II device (Lonza, Köln, Germany). Directly after transfection 50 µl RPMI-1640 complete was added to the transfection reaction followed by intravenous injection into one SWISS mouse ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were validated by sequencing to contain KRAS and TP53 mutations and verified as Mycoplasma negative (MycoAlert Mycoplasma Detection Kit, Lonza, LT07-701). All cells were maintained in monolayer culture at 37°C and 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... All parasite strains and host cell lines were routinely tested for mycoplasma contamination with the MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland) and found to be negative.
-
bioRxiv - Genomics 2023Quote: ... Each plasmid library was transfected into K562 or A549 cells by electroporation using Lonza SF Cell Line 4D-Nucleofector X Kit (Lonza V4XC-2012) with Lonza 4D-Nucleofector ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were authenticated by STR profiling (Eurofins, Val Fleuri, Luxembourg) and were tested negative for mycoplasma (MycoAlert PLUS mycoplasma detection kit, Lonza, Basel, Switzerland).
-
The spindle protein CKAP2 regulates microtubule dynamics and ensures faithful chromosome segregationbioRxiv - Cell Biology 2023Quote: ... and immediately transfected by Nucleofection into HT-1080 cells using the Amaxa SF Cell Line 4D-Nucleofector X kit S (Lonza, PBC2-00675) and either program FF-113 (HT1080 ...
-
bioRxiv - Bioengineering 2023Quote: ... 100,000 cells were resuspended in 20μl P3 reagent of the P3 Primary Cell 4D-Nucleofector® X Kit S (Lonza V4XP-3032). 1 μg total plasmid was used for a single nucleofection event and nucleofected by program EH-100 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Molecular Biology 2023Quote: ... MCF-10A human mammary gland cells were used as the non-tumorigenic control and were cultured in MEBM basal medium supplemented with components included in the MEGMTM Mammary Epithelial Cell Growth Medium SingleQuotsTM Kit (Lonza, Hayward, CA). A549 human lung carcinoma cells were cultured in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Immunology 2023Quote: ... Constructs were transiently transfected into KRT17 null A431 cells using the SF Cell Line 4D-Nucleofector™ X Kit (Lonza #V4XC-2032) and Lonza 4D-nucleofector X unit “A431 cell” program ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1.5 x 106 cells were transfected with 1 µg DNA (500 ng Cas9 plasmid and 500 ng linearized donor plasmid) by nucleofection (pulse code CA137) using P3 Primary Cell 4D-Nucleofector X kit (Lonza, V4XP-3024) in a 4D-Nucleofector (Lonza ...
-
bioRxiv - Immunology 2023Quote: ... T cells were then rinsed with PBS and 10 × 106 cells were resuspended in 20 µl of P4 primary cell nucleofection solution (P4 Primary Cell 4D-Nucleofector X Kit S, Lonza V4XP-4032). 20 μL of resuspended T cells were then gently mixed with 5 µL of RNP complex and incubated for 2 minutes at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... coated tissue culture polystyrene (TCPS) and maintained at 37° Celsius and 5% CO2 in endothelial growth medium (EGM-2 with bullet kit; Lonza, CC-3162) supplemented with 1% penicillin/streptomycin (Corning ...
-
bioRxiv - Genetics 2024Quote: ... 3x105 Daudi cells were nucleofected with 20 picomole of sgRNA-Cas9 complex and 100 picomole of DNA donor template using program CA137 of Amaxa 4D-Nucleofector and SF cell line kit S (Lonza, V4XC-2032). The edited single-cell clones were sorted into 96-well plate by BD Aria II sorter and expanded for 4 weeks ...
-
bioRxiv - Neuroscience 2024Quote: ... following a previously described protocol.43-44 Cultures underwent testing every other month using the MycoAlert Mycoplasma Detection Kit (Lonza LT07-318) and consistently tested negative for mycoplasma throughout the study.
-
bioRxiv - Cell Biology 2024Quote: ... was transfected into 106 U2OS cells using the Amaxa Nucleofector System with the Cell Line Nucleofector Kit V (catalog no: VCA-1003, Lonza, Cologne, Germany) utilizing program X-001 according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1.2 μl of Alt-R® Cas9 Electroporation enhancer (100 μM, IDT) using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza). After electroporation ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were authenticated and routinely tested to be mycoplasma-free using the MycoAlert Mycoplasma Detection Kit (Lonza, Cat # LT07-710) every two months ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mycoplasma testing was performed on all cells when they were thawed and semi-regularly thereafter using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza LT07-703). Independent experiments were performed on cells treated with siRNA and/or compounds from separate passages of each cell line ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were authenticated by short tandem repeat analysis and routinely tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, #LT07-710).
-
bioRxiv - Cell Biology 2024Quote: ... Cells were maintained at 37°C and 5% CO2 in 2D monolayer culture and confirmed as Mycoplasma negative (MycoAlert Mycoplasma Detection Kit, Lonza #LT07-701). Cells were maintained in DMEM medium (Corning #10-013-CV ...
-
bioRxiv - Cell Biology 2024Quote: ... 8 x 105 H9 hESCs in single-cell suspension were resuspended in 100 µL electroporation buffer from the Human Stem Cell Nucleofector Solution 2 kit (Lonza, VPH-5022). Alt-R Cas9 Electroporation enhancer (1.1 µM ...
-
bioRxiv - Systems Biology 2024Quote: ... HiFi Cas9 Nuclease V3 protein (IDT, 1081058) were introduced into low-passage dual-reporter ESCs using the Mouse Embyronic Stem Cell Nucleofector Kit (Lonza VPH-1001). ESCs were treated with 0.025% trypsin/1% EDTA (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... In microscopy experiments we used the same media but without phenol red to reduce background fluorescence (Lonza CC-3153 phenol-red free basal media supplemented with growth factors and other components from the Lonza CC4136 kit). T98G cells were purchased from ATCC ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells in passage 1 were trypsinized and resuspended (3 × 104 cells/mL) in BEGM** (Lonza, see Table S4 for details of media composition ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... 1 μg plasmid DNA was added and cells electroporated in a 4D-NucleofectorTM System (Lonza) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... ~1 μl of cells were mounted on EMM4S agarose pads (1.4% InCert™ Agarose, Lonza) and sealed under a coverslip with VALAP (Vaseline ...
-
bioRxiv - Bioengineering 2020Quote: ... and the injury site was covered completely with a layer of 1% sterile SeaKem (Lonza) agarose ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1×106 Primary Human T cells were electroporated using the 4D-nucleofector (Lonza, Basel, Switzerland) and a P3 Primary Cell 4D-Nucleofector™ X Kit (V4XP-3032) ...
-
bioRxiv - Cell Biology 2021Quote: Astrocytes were transfected with siRNAs (1-5nM) or plasmids (5µg) using a Nucleofector machine (Lonza) and the appropriate Lonza glial cell nucleofector solution ...
-
bioRxiv - Immunology 2021Quote: ... . THP-1 cells were transfected with the plasmid using the Amaxa Nucleofector 2b device (Lonza) and the Human Monocyte Nucleofector Kit (Lonza ...