Labshake search
Citations for Lonza :
2201 - 2250 of 2843 citations for Human Mitochondrial Open Reading Frame Of The 12S rRNA c MOTS c CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... gRNA and Cas9 containing plasmids were introduced to prostate epithelial cells using the basic nucleofector kit (Amaxa, Lonza) following the manufacturer’s instructions for primary mammalian epithelial cells (program W001) ...
-
bioRxiv - Immunology 2021Quote: ... The P14 cell/Cas9/RNP mixes were transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Neuroscience 2020Quote: ... All cell lines were tested for mycoplasma prior to experimental work using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Microbiology 2021Quote: ... All cell lines used in this report were routinely checked for mycoplasma contamination (MycoAlert Mycoplasma Detection Kit, Lonza) and were authenticated by the respective vendors ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were verified to be free of mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza, Allendale, NJ) and passaged when reaching 80% confluence.
-
bioRxiv - Cancer Biology 2021Quote: ... All cell lines were confirmed to be mycoplasma-free using the MycoAlert mycoplasma detection kit (Lonza: LT07-218).
-
bioRxiv - Cancer Biology 2020Quote: ... The presence of mycoplasma was tested for frequently in all cell lines with a MycoAlert kit (Lonza, Switzerland), exclusively using mycoplasma-free cells in all the experiments carried out.
-
Interactions with stromal cells promote a more oxidized cancer cell redox state in pancreatic tumorsbioRxiv - Cancer Biology 2020Quote: ... PDAC cells grown as 3D organoids were regularly tested for mycoplasma contamination using the MycoAlert Plus kit (Lonza) or the Mycoprobe Mycoplasma Detection Kit (R&D Systems).
-
bioRxiv - Cell Biology 2021Quote: ... The cell line were regularly tested for mycoplasma contamination by MycoAlert PLUS Mycoplasma Detection Kit (Lonza, LT07-703). Cells were transiently transfected with expression vectors using jetPRIME transfection reagent (Polyplus transfection ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lines were monitored monthly to maintain mycoplasma-negative status using the MycoAlert Mycoplasma Detection Kit (Lonza, USA).
-
bioRxiv - Neuroscience 2021Quote: ... counted and 2×106 cells were transfected using the Basic Nucleofector kit for primary neurons (VAPI-1003, Lonza) and the D-33 programme on the Amaxa Nucleofector II B device (Amaxa Biosystems) ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cells were screened – free from mycoplasma using MycoAlert™ Mycoplasma Detection kit (LT0-118, Lonza group Ltd.) and MycoAlert™ control set (LT07-518 ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 × 106 trypsinized cells were resuspended in 93.5 µl solution (mouse ES cell nucleofector kit, VPH-1001, Lonza). The solution includes 2 µg of each CRISPR/Cas9 vector (4 µg total ...
-
bioRxiv - Bioengineering 2022Quote: ... The iECs were cultured in endothelial cell growth medium 2 kit supplemented into basal media (except hydrocortisone, Lonza) with 1x GlutaMax (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... 1×106 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
bioRxiv - Neuroscience 2021Quote: ... coated coverslips in a 24-well plate in 1ml Endothelial Growth Media-2 Bullet Kit (EGM-2; Lonza; Endothelial basal media-2 with 2% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Microbiology 2020Quote: Electroporation was performed using the Amaxa P3 Primary Cell 96-well Nucleofector kit and 4D Nucleofector system (Lonza). Recombinant S ...
-
bioRxiv - Neuroscience 2021Quote: ... freshly isolated cortical neurons were transfected using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, LZ-V4XP-3024) and the program DC-104 of the 4D-Nucleofector device (Lonza) ...
-
bioRxiv - Cell Biology 2021Quote: ... RNP was delivered by electroporation using a Lonza 4D-nucleofector and P3 Primary Cell Kit (Lonza, V4XP-3012). Cells were transferred to fresh StemSpan media and corresponding (AK2 or AAVS1 ...
-
bioRxiv - Immunology 2019Quote: ... All Cell lines were Mycoplasma-free as determined with the MycoAlert mycoplasma detection kit (Lonza, Walkersville, MD, USA) and were carried no more than 20 passages from the validated stocks.
-
bioRxiv - Genetics 2022Quote: ... were cultured in RtEGM with supplement medium as indicated by the manufacturer’s protocol (RtEGM bullet kit, Lonza, #00195409). HfRPE cells were cultured to high confluence on coverglass culture plates (Thermo ...
-
bioRxiv - Immunology 2022Quote: ... 1 x 10^6 purified naive T-cells were resuspended in 15µL buffer P3 + 5µL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7µL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Cell Biology 2019Quote: Stably transfected U2OS cells were generated using using Cell Line Nucleofector Kit V and a Nucleofector electroporator (Lonza). After 24 hours ...
-
bioRxiv - Molecular Biology 2019Quote: ... Both cell lines tested negative for mycoplasma using a MycoAlert™ Mycoplasma Detection Kit (catalogue no. LT07; Lonza) and cultured in a humidified 5% CO2 atmosphere at 37 °C ...
-
bioRxiv - Pathology 2020Quote: ... Plasmid delivery through electroporation of passage three neurospheres was performed using Mouse neural stem cell nucleofector kit (Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... H2228 cells were electroporated with 3ug DRGFP substrate using reagent T (Amaxa Cell Line Nucleofector Kit T, Lonza), program X-001 on the Nucleofector 2b (Lonza) ...
-
bioRxiv - Microbiology 2020Quote: ... 1 million Jurkat T-cells were resuspended in 100 μL Nucleofector solution (Cell Line Nucleofector™ Kits, Lonza) and combined with 2 μg of the linearized dual-fluorophore vector and 2 μg of the corresponding gRNA/Cas9 plasmid ...
-
bioRxiv - Bioengineering 2021Quote: ... All cell lines were tested for mycoplasma every 3 months using MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland). All cells used were <20 passages from thaw.
-
bioRxiv - Molecular Biology 2020Quote: ... Cells lines all tested negative for mycoplasma with the MycoAlter PLUS Mycoplasma Detection Kit (Lonza cat.#LT07-703). Lentivirus packaging was conducted at the Gene Vector and Virus Core of Stanford University or performed in-house using lentiviral constructs by co-transfection with ΔVPR ...
-
bioRxiv - Genomics 2021Quote: ... Cells were regularly passaged and tested for presence of mycoplasma contamination with MycoAlert Plus Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Genomics 2021Quote: ... K562 cells were grown to 1×106 and transfected with 1,000ng of gRNA plasmid and 3,000 ng of pCMV_AncBE4max_P2A_GFP (Amaxa® Cell Line Nucleofector® Kit V, Lonza). K562 cells were cultured for an additional 48 hours then single clones of green cells were isolated using flow cytometry (Aria II) ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the Cell Line Nucelofector Kit V and the Amaxa Nucleofector II Device (Lonza Group AG, Basel, CH). Stable cells were selected for with 1mg/mL hygromycin B (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... EB3-mCherry construct (Stepanova et al., 2003) was transiently transfected using Amaxa Cell Line Nucleofector kit V (Lonza), program X-001.
-
bioRxiv - Cell Biology 2020Quote: ... Both cell lines were regularly tested for mycoplasma contamination by MycoAlert PLUS Mycoplasma Detection Kit (Lonza, LT07-703). REF52 cells were transiently transfected with mEos3.2-Actin expression vector (Michael W ...
-
bioRxiv - Immunology 2022Quote: ... All cell lines were confirmed to be free of mycoplasmas using the MycoAlert detection kit (Lonza, Basel, Switzerland). Cells were detached in PBS EDTA 5mM without enzymatic solution to avoid HVEM cleavage.
-
bioRxiv - Cancer Biology 2022Quote: ... All cells were negative for Mycoplasma upon regular testing with the MycoAlert Mycoplasma Detection Kit (Lonza; LT07-318). LARP1 knockout cell line generation was performed using Edit-R™ CRISPR-Cas9 Gene Engineering ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were routinely tested for mycoplasma contamination using MycoAlert PLUS mycoplasma detection kit (Lonza, MD, USA) and molecularly characterised using an “in house” panel of cellular and molecular markers to check that cell lines have not been cross contaminated (every 3-6 month) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cell lines were regularly tested and verified to be mycoplasma negative using MycoAlert PLUS Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were regularly tested for mycoplasma contamination using a biochemical test kit (#LT07-318, Lonza, Switzerland) and were free of mycoplasma contamination.
-
bioRxiv - Cell Biology 2022Quote: ... 25 μg mRNA was transfected into 2.5 × 106 freshly thawed fibroblasts using Cell Line Nucleofector Kit V (Lonza) and AMAXA program X-001 following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of these dominant-negative Rab11 a and siRab11 a into mouse MΦs (RAW 264.7 cell line) were performed with Amaxa mouse macrophage nucleofector kit (VPA-1009, Lonza) and DharmaFECT 4 Transfection Reagent (T-2004-01 ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were routinely tested for mycoplasma contamination by using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cultures were confirmed to be free of mycoplasma infection using the MycoAlert Mycoplasma Detection Kit (Lonza, Walkersville, MD). Briefly ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and Jurkat cell lines tested negative for mycoplasma with the MycoAlert Mycoplasma Detection Kit (Lonza Cat #LT07-318).
-
bioRxiv - Immunology 2023Quote: ... 1×10e6 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... and nucleofection was performed as per the manufacturer’s recommendations (Lonza, SG Cell Line 4D-Nucleofector X Kit S). Monoclonal isolation of the knockouts were performed by limiting dilution ...
-
bioRxiv - Molecular Biology 2024Quote: ... iMEPM cells were tested for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza Group Ltd, Basel, Switzerland). Packaged lentiviruses containing pLV[shRNA]-EGFP:T2A:Puro-U6>Scramble_shRNA (vectorID ...
-
bioRxiv - Neuroscience 2024Quote: ... we used the 4D-Nucleofector system and Amaxa P3 primary Cell 4D-Nucleofector X Kit S from Lonza. The electroporation buffer used was P3 primary cell Nucleofector Solution with Supplement 1 (Lonza) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Immunology 2024Quote: ... 1 - 2.5 × 106 Jurkat T cells were resuspended in EP buffer from the Nucleofector® Kit V (Lonza). Cells were combined with 1.5 μg of donor plasmid in a reaction volume of 100 μL and electroporated on the Amaxa® Nucleofector® II using pulse code X-005.