Labshake search
Citations for Lonza :
2101 - 2150 of 9615 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 500 U/ml streptomycin (penstrep; Lonza Bioscience), 2 mM glutaMAX (Gibco) ...
-
bioRxiv - Immunology 2023Quote: ... cells were washed with PBS and media was replaced with serum-free UltraCULTURE media (Lonza) or phenol red-free DMEM with 10% FBS (Thermo-Fisher) ...
-
bioRxiv - Immunology 2023Quote: Cells were then washed with PBS and resuspended in 20 µL of SF (K562) or SG (Raji and Ramos) buffer (Lonza) and mixed with Cas9 RNPs ...
-
bioRxiv - Immunology 2023Quote: ... cells were also mixed with 1.4- 2 µg of plasmid homology donors or 100 pmol phosphorothioate-modified ssODNs as previously described.59 Electroporations were performed with the 4D-X Nucleofector (Lonza). K562 cells used pulse code FF-120 ...
-
bioRxiv - Physiology 2023Quote: ... 6 of the samples were randomly selected and stained with AdipoRed (Lonza, Walkersville, MD) (1:35 ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of KCNQ2/3 cDNA plasmid (0.9 g/l) and 1 μl of pmax green fluorescent protein vector (0.5 g/l) (Lonza, Cologne, Germany) were diluted in 125 μl of Opti-MEM medium (Life Technologies) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza, V4XP-3012) and the CA-137 program ...
-
bioRxiv - Developmental Biology 2023Quote: ... using P3 Primary Cell 4D-Nucleofector X kit (Lonza). Transfected cells were plated onto irradiated DR4 MEFs (the Cell Bank of the Chinese Academy of Sciences ...
-
bioRxiv - Developmental Biology 2023Quote: ... using P3 Primary Cell 4D-Nucleofector X kit (Lonza). Transfected cells were plated onto irradiated DR4 MEFs (the Cell Bank of the Chinese Academy of Sciences ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μg of assembled pGL3 plasmid were electroporated into 2.5×105 AIC-H9-hESCs 35 by 4D-Nucleofector (Lonza) using P3 Primary Cell 4D-Nucleofector X kit (Lonza) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell lines were routinely checked for mycoplasma contaminations using MycoAlert Mycoplasma Detection Kit (LONZA, LT07-318) every two weeks ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Tissues were either commercially available (MucilAir™, Epithelix) or prepared in-house from hAECs (Epithelix, Lonza). Measured tissues originated from six F508del homozygous patients (CF patient #1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... non-CF#4 (CC-2540S -20TL356517, Lonza, female, 48 years-old). hAEC cells were cultured for several days until reaching 90-95% confluency in complete PneumaCultExPlus medium ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CF patient# 3 (#28388-0000450918, Lonza, male, 25 years-old) and four non-CF donors with no pathology reported ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were maintained in a 100 mm cell culture dish using SmGM2 Smooth Muscle Cell Growth Medium BulletKit (SmGM2, CC-3182, Lonza, Basel, Switzerland) at 37 °C in a humidified atmosphere with 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... were cultured at 27°C in Insect-XPRESS protein-free insect medium with L-Glutamine (Lonza) in shaking suspension ...
-
bioRxiv - Cell Biology 2023Quote: ... Percoll-purified [131] parasites at late schizont stage were transfected with 50 µg plasmid DNA using Amaxa Nucleofector 2b (Lonza, Switzerland) as previously described [135] ...
-
bioRxiv - Molecular Biology 2023Quote: ... Transfection of either free merozoites carried out in a 4D-Nucleofector System (Lonza), using the FP158 electroporation settings ...
-
bioRxiv - Molecular Biology 2023Quote: ... was resuspended in 110 µl P3+DNA solution (Lonza Cat. No. V4Xp-3024). Transfection of either free merozoites carried out in a 4D-Nucleofector System (Lonza) ...
-
bioRxiv - Microbiology 2023Quote: ... Cytotoxicity was measured via ToxiLight Assay (Lonza) in triplicate HAE cell cultures treated with 10 ...
-
bioRxiv - Pathology 2023Quote: ... 1% penicillin/streptomycin (Lonza, DE17-602DE) and 5% fetal bovine serum (PAA ...
-
bioRxiv - Physiology 2023Quote: ... Preadipocyte cells were maintained in preadipocyte growth media-2 (Lonza Cat #PT-8002). For experiments ...
-
bioRxiv - Physiology 2023Quote: Human Subcutaneous Preadipocytes (Lonza Catalog #: PT-5020) were utilized for human Adipocyte experiments ...
-
bioRxiv - Physiology 2023Quote: ... an adipored assay was performed with the remaining cells (Lonza Adipored Assay Reagent #PT-7009) for each sample used in the ELISA to confirm similar levels of adipocyte development and intracellular triglyceride was present amongst samples being compared ...
-
bioRxiv - Physiology 2023Quote: ... USA) were cultured in 5% fetal bovine serum containing endothelial cell growth medium (EGM-2; Lonza, Basel, Switzerland). Media was supplemented with heparin ...
-
bioRxiv - Physiology 2023Quote: ... and growth factors (EGM-2 SingleQuot; Lonza, Basel, Switzerland). Cells were used at passage 2-5 and plated onto 8 well chamber slides (Ibidi ...
-
bioRxiv - Physiology 2023Quote: ... Cryopreserved human aortic smooth muscle cells were obtained from Lonza Pharma and Biotech (Catalog # ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... All cells were screened for mycoplasma contamination with a MycoAlert mycoplasma detection kit (Lonza, Basel, Switzerland) prior to use.
-
bioRxiv - Pathology 2023Quote: Differentiated C2C12 myotubes were incubated in serum-free glucose (4.5 g/L) and L-glutamine (0.6 g/L) DMEM (#BE12-741F, Lonza) with 1% Penicillin-Streptomycin (10,000 U/ml ...
-
bioRxiv - Pathology 2023Quote: ... was maintained in growth media comprised of high glucose (4.5 g/L) and L-glutamine (0.6 g/L) Dulbecco’s Modified Eagle’s Media (DMEM) (#BE12-741F, Lonza), 10% foetal bovine serum (FBS ...
-
bioRxiv - Pathology 2023Quote: ... C2C12 myoblasts were differentiated into myotubes in a differentiation media comprised of high glucose (4.5 g/L) and L-glutamine (0.6 g/L) DMEM (#BE12-741F, Lonza), 2% horse serum (HS ...
-
bioRxiv - Systems Biology 2023Quote: ... using the P3 Primary cell 4D-nucleofector X kit S from Lonza (V4XP-3032) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... cells were then switched to differentiation media (Lonza Cat #PT-8002) for seven days to allow for differentiation into mature primary adipocytes and development of lipid droplets ...
-
bioRxiv - Physiology 2023Quote: ... HEK293T cells and Human subcutaneous preadipocytes (Lonza Catalog #: PT-5020) were used for all cell culture-related experiments ...
-
bioRxiv - Physiology 2023Quote: ... Preadipocyte cells were maintained in preadipocyte growth media-2 (Lonza Cat #PT-8002).
-
bioRxiv - Developmental Biology 2023Quote: ... in PBS (Lonza) with 0.02% BSA (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... Electroporation of the RNP complex was carried out using the SF Cell Line 4D-Nucleofector kit (Lonza) and program CM-130 with 2.0×105 cells ...
-
bioRxiv - Cell Biology 2023Quote: ... All cells were routinely checked for mycoplasma contamination (MycoAlert, Lonza).
-
bioRxiv - Cell Biology 2023Quote: ... www.addgene.org) (Okita et al., 2011)plus or minus pHBx on Amaxa Nucleofector (Lonza, Cologne, France) using the manufacturer’s protocol for human dermal fibroblasts ...
-
bioRxiv - Genomics 2023Quote: ... ATCC #CRM-CRL-1420) and PANC-1 cells (CVCL_0480, ATCC #CRM-CRL-1469) were cultured in D10 media: DMEM (Lonza #12-614Q) supplemented with 10% FBS (GELifeSciences #SH30071.03) ...
-
bioRxiv - Cancer Biology 2023Quote: 1 x 103 cells per dish were plated onto 35mm dishes in 0.4% NuSieve Agarose (Lonza #50081). Six replicates of each condition were plated ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated B-cells were kept on ice in DMEM (Lonza) supplemented with 0.6% BSA (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... using program CM134 of the 4D-Nucleofector (Lonza). Cells were allowed to synthesize Neo protein product for 72 hours before initiating antibiotic selection ...
-
bioRxiv - Genomics 2023Quote: 200,000 PUER cells were transfected with 500ng each of Cas9 and donor vector in SF buffer (Lonza, V4SC-2096) using program CM134 of the 4D-Nucleofector (Lonza) ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (75 µg/ml, Lonza, BE02-033E20), 10% Fetal Calf Serum and 2.5% fly extract (Drosophila Genomics Resource Center ...
-
bioRxiv - Immunology 2023Quote: ... suspended in a concentration of 1.5×106 in 100 µl cell line nucleofector solution T (Lonza) and nucleofected with 5 μg of a plasmid using program X-001 in the Nucleofector IIb device (Lonza ...
-
bioRxiv - Immunology 2023Quote: ... and nucleofected with 5 μg of a plasmid using program X-001 in the Nucleofector IIb device (Lonza) according to the manufacturer’s procedure ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.1 mM not essential amino acids (Lonza, BE13114E) and 100 U/ml Penicillin and Streptomycin (Euroclone ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293T cells were grown in DMEM with Glucose and L-Glutamine (Lonza, BE-12-604Q) supplemented with 10% fetal bovine serum (FBS ...