Labshake search
Citations for Lonza :
151 - 200 of 1483 citations for 7 Chloro 5 methyl 1H pyrrolo 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... All the cells were maintained in a humidified incubator with 5% CO2 at 37 °C and tested negative for mycoplasma by MycoAlert (Lonza, Morristown, NJ). Cells from passage 14-15 (P14-15 ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 humidity and were tested routinely for mycoplasma using MycoAlert mycoplasma detection kit (Lonza, LT07-318) and appropriate positive control (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: ... HUVEC cells were maintained in growth factor-supplemented media (EBM + EGM-2 aliquots + 10% FBS) from Lonza (C-3121, CC-4542). MDA-MB-231 cell line was modified to express GFP (green fluorescent protein ...
-
bioRxiv - Neuroscience 2024Quote: ... digested for 3 min at 37 °C in Accutase and then resuspended in 60 μL nucleofection buffer from the Human Stem Cell Nucleofector™ Kit 2 (Lonza). The suspension was combined 2 μM Electroporation Enhancer (IDTDNA ...
-
bioRxiv - Microbiology 2021Quote: ... HXGPRT amplicon (2-5 µg) into 1x106 RH TIR1-3FLAG tachyzoites in P3 buffer using a 4D-nucleofector (Lonza) with pulse code FI-158 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were cultured at 37°C and 5% CO2 in DMEM (H3BE12-604F/U1, Lonza Group AG [Cultek S.L.U, Madrid, Spain]) supplemented with 10% tetracycline-free FBS (631106 ...
-
bioRxiv - Molecular Biology 2023Quote: ... were grown in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expanded in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 12.5% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... plates were incubated at 37°C for 30 minutes in blocking buffer (PBS with 1% BSA, 5% FBS, and 1% human AB serum (Lonza, Walkersville, MD, USA), washed three times in PBS with 0.05% tween 20 and incubated with a commercial anti-SARS-CoV-2 Spike antibody (1/1000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were incubated at 37°C in a humidified incubator with 5% CO2 and frequently tested for mycoplasma contamination using MycoAlert™ detection kit (Lonza, LT07-118).
-
bioRxiv - Immunology 2023Quote: ... Cells were cultured at 37°C with 5% CO2 and were regularly tested for mycoplasma contamination using the MycoAlert® PLUS Mycoplasma Detection Kit (Lonza, LT07-703), and authenticated by Microsynth ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: HUVEC cells were grown at 37° C in the Endothelial cell basal medium-2 (LONZA #Cat No-CC-3156 and CC-4176) under the atmosphere containing 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: HUVEC cells were grown at 37o C in the Endothelial cell basal medium-2 (LONZA #Cat No-CC-3156 and CC-4176) under the atmosphere containing 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: HUVEC cells were grown at 37o C in the Endothelial cell basal medium-2 (LONZA #Cat No-CC-3156 and CC-4176) and were used with or without addition of drugs and LPS (0.5 ug/ml ...
-
bioRxiv - Cell Biology 2022Quote: COS-7 and U2OS cells were grown in DMEM (Lonza, 12-604F) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Bioengineering 2019Quote: ... MCF-7 cells were cultured in DMEM low glucose medium (Lonza, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested on day 7 with 1 X PBS EDTA (Lonza).
-
bioRxiv - Bioengineering 2023Quote: Primary human umbilical vein endothelial cells (HUVECs; Lonza; passages 4 to 7) were cultured on dishes in Endothelial Cell Growth Medium-2 (EGM-2 ...
-
bioRxiv - Microbiology 2019Quote: ... All experiments were done with cells at passage 2 to 5 and cells were regularly checked for mycoplasma contamination (MicoAlert Lonza).
-
bioRxiv - Cell Biology 2019Quote: ... HUVE cells were cultured in endothelial growth medium supplemented with 5% fetal bovine serum (FBS) and growth factors (EGM-2; Lonza). HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Immunology 2021Quote: ... CD3/CD28 beads were removed 48 hours after stimulation and 5 × 106 CTLs were electroporated with 2 μg plasmid using 4D-Nucleofector (Lonza). Medium was changed 6 hours after nucleofection and transfected cells were used 24-36 hours after electroporation ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary MEC were cultured in endothelial growth media (EGM) containing 5% FBS with growth factors (EBM-2; Lonza, Basel, Switzerland) at 37°C in 5% CO2 ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines were cultured at 37°C and 5% CO2 and tested for mycoplasma contamination using a MycoAlert® mycoplasma detection kit (Lonza, cat: LT07-218). Only mycoplasma-negative cells were used.
-
bioRxiv - Cell Biology 2020Quote: HUVECs (Lonza, C-2519A) were cultured in EGM medium (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: ... (kit C, W001; Lonza) and CD81 positive cells sorted (ARIA III BD ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells and COS-7 cells (ATCC) were cultured in DMEM medium (Lonza) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Immunology 2020Quote: ... The cells were cultured in a humidified chamber at 37 °C under 5% CO2 and were routinely tested for mycoplasma contamination using MycoAlert plus detection kit (Lonza, Basel, Switzerland; cat. LT07-701).
-
bioRxiv - Genomics 2019Quote: ... The products were size selected on a 3% NuSieve 3:1 Agarose gel (Lonza), purified using NucleoSpin Gel and PCR clean-up columns ...
-
bioRxiv - Cell Biology 2022Quote: ... and CD31+Rspo3+ cells were centrifuged at 500 g for 5 min and resuspended in 500 μl endothelial cell media: EGM-2 MV Bullet Kit (Lonza, cc-3202) supplemented with 50 ng/mL VEGF-C (R&D ...
-
bioRxiv - Cell Biology 2024Quote: ... coated tissue culture polystyrene (TCPS) and maintained at 37° Celsius and 5% CO2 in endothelial growth medium (EGM-2 with bullet kit; Lonza, CC-3162) supplemented with 1% penicillin/streptomycin (Corning ...
-
bioRxiv - Bioengineering 2023Quote: ... in 6-well tissue culture plates and were allowed to adhere for 5 hours before induction of serum starvation in EBM-2 (LONZA, Cat# CC-3156) for 16 hours prior to being administered media of interest ...
-
bioRxiv - Physiology 2023Quote: ... were purchased from PromoCell (#C-12203 / C-12253) and cultured in endothelial cell basal medium (EBM, #CC-3121, Lonza) supplemented with EGM-SingleQuots (CC-4133 ...
-
bioRxiv - Immunology 2021Quote: Commercially available human primary PTs from 6 donors (3 males and 3 females, Lonza Walkersville Inc) were expanded at passage 4 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 ml of 2% SeaPlaque™ Agarose (Lonza) in DMEM containing 2% FBS and 1% penicillin/streptomycin (P/S ...
-
bioRxiv - Microbiology 2021Quote: ... 2◻ml of 2% Seaplaque agar (Lonza) in Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... 2◻ml of 2% Seaplaque agar (Lonza) in DMEM containing 2% FBS ...
-
bioRxiv - Biophysics 2021Quote: ... HUVECs (Lonza, expanded to passage 3) were transduced with GFP tagged VE-cadherin (65 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 μg of pmaxGFP plasmid (Lonza) was added to transfection mixes to monitor transfection efficiency ...
-
bioRxiv - Immunology 2023Quote: ... and cells were harvested on day 7 using 1 X PBS EDTA (Lonza, BE02-017F) for experiments.
-
bioRxiv - Bioengineering 2020Quote: ... HUVECs were cultured in Endothelial Growth Medium 2 (EGM-2) and NHLFs were cultured in Fibroblast Growth Medium 2 (FGM-2) (Lonza, Walkersville, MD). All cells were cultured in incubators at 37 °C and 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Human umbilical vein endothelial cells (HUVEC) cells were grown at 37° C in the Endothelial cell basal medium-2 (LONZA #Cat No-CC-3156 and CC-4176) under the atmosphere containing 5% CO2 ...
-
bioRxiv - Bioengineering 2021Quote: ... were purchased from Lonza and cultured in EGM-2 and FGM-2 (Lonza) supplemented with EGM-MV and FGM-2 Bullet Kit ...
-
bioRxiv - Bioengineering 2022Quote: ... Endothelial Cell Growth Medium-2 (EGM-2, Lonza, Switzerland) was used as the medium ...
-
bioRxiv - Cell Biology 2020Quote: ... and 7 mM Na2HPO4 in nuclease-free water) using either the Amaxa nucleofector system II (Lonza) under nucleofection program T-005 or the Amaxa 4Dnucleofector system (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 µg mRNA was transfected into 0.5× 106 fibroblasts using Cell Line Nucleofector Kit V (Lonza) and AMAXA program X-001 following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... The DNA fragments of 150–200 bp length were gel-extracted on 3% NuSieve 3:1 Agarose (Lonza). Both samples were sequenced by GATC Biotech AG (Konstanz ...