Labshake search
Citations for Lonza :
51 - 100 of 1483 citations for 7 Chloro 5 methyl 1H pyrrolo 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Between 1×10^3 – 5×10^4 cells were re-suspended in 20μl Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the CRISPR/Cas9 gRNA RNP complex ...
-
bioRxiv - Biophysics 2022Quote: ... CD146 positive cells were retained in the column and flushed with 5 mL warmed EGM-2 growth medium supplemented with EGM-2 bullet kit (Lonza) into a separate tube ...
-
bioRxiv - Biophysics 2023Quote: ... Any CD146 positive cells were eluted from the column using 5 mL warmed EGM-2 growth medium supplemented with EGM-2 bullet kit (Lonza). The cells were pelleted with a 300 g spin for 5 min and counted in 1 mL EGM-2 media ...
-
bioRxiv - Biophysics 2023Quote: ... 95% humidity and 5% CO2 in Fibroblast Growth Medium (FGM-2, Lonza, Basel).
-
bioRxiv - Biophysics 2019Quote: Zebrafish between 9 and 13 dpf were anesthetized with Tricaine-S (MS-222, Pentaire; .008% w/v, buffered to pH 7) and embedded in 2% low melting point agarose (Lonza SeaPlaque, #50100) with .004% w/v Tricaine ...
-
bioRxiv - Neuroscience 2022Quote: ... The cells were cultivated together with mixed glial cells plated on the bottom of 12-well plates for 7 days in EBM-2 medium (Lonza, Basel, Switzerland) containing 15% PDS ...
-
bioRxiv - Physiology 2022Quote: ... (5 g/L trypsin and 2 g/L EDTA diluted 1 in 5 in calcium- and magnesium-free PBS) (Lonza, UK).
-
bioRxiv - Cancer Biology 2021Quote: Primary human lung microvascular endothelial cells (HMVEC-L) were seeded at 5000 cells/cm2 in EBM-2 with 5% FBS and EGM-2 supplement (all products, Lonza Bioscience) until reaching complete confluence 14 ...
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Immunology 2023Quote: ... MEFs were allowed to expand for 2-3 days before harvest with 0.05% trypsin-EDTA (Lonza). iBMDMs were immortalized with J2 virus to generate iBMDMs.
-
bioRxiv - Immunology 2021Quote: ... coated dishes (5 ng/cm2) and cultured in Endothelial Growth Medium 2 (EGM2, Lonza) supplemented with 50 ng/mL VEGF with medium changes every other day until they reached confluency ...
-
bioRxiv - Microbiology 2024Quote: ... of 0.01 and incubated at 37 °C for 5-6 days in Dulbecco’s modified Eagle’s medium (DMEM; Lonza) with 2% FBS (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cusps were placed in a petri dish filled with VEC medium (EGM™-2 MV Microvascular Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, #C-3202)) and VECs were scraped into the medium using a sterile scalpel ...
-
bioRxiv - Immunology 2022Quote: ... Thawed PBMCS were rested for 3-4h at 37°C in X-VIVO 15 Serum-free Hematopoietic Cell Medium (Lonza) supplemented with 5% human Ab serum ...
-
bioRxiv - Neuroscience 2019Quote: COS-7 cells were maintained in DMEM (Lonza) supplemented with 10 % FBS (Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: ... It was grown at 37°C in 5% CO2 in Eagle’s Minimum Essential Medium (EMEM, Lonza, Allendale, NJ) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2021Quote: Human and mouse fibroblasts were cultured at 37°C and 5% CO2 in Dulbecco’s modified Eagle’s medium (Lonza) with high glucose supplemented with 10% foetal bovine serum ...
-
bioRxiv - Cell Biology 2022Quote: ... were cultivated at 37°C with 5% CO2 in DMEM (Dulbecco’s Modified Eagle’s Medium, Lonza Cat. #BE12-614F) with 10% fetal bovine serum albumin (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... and HEK293 cells expressing mouse TRPV2 in a stable manner were grown at 37 °C with a 5% CO2 humidified atmosphere in Dulbecco’s Modified Eagle’s Medium (DMEM, Lonza). The DMEM was supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... were incubated at 37°C in a 5% CO2 humidified atmosphere and propagated in Dulbecco’s modified Eagle’s medium (DMEM; Lonza) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were stored in humidified incubators at 37 °C with 5% CO2 and routinely checked for mycoplasma (Lonza).
-
bioRxiv - Cell Biology 2023Quote: Human mammary epithelial cells (HMECs) were cultured at 37°C with 5% CO2 in MEBM basal medium (Lonza) supplemented with MEGM SingleQuots (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... were incubated at 37°C in a 5% CO2 humidified atmosphere and propagated in Dulbecco’s modified Eagle’s medium (DMEM; Lonza) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were used from passages 5-9 for the experiments and were cultured in endothelial cell growth Medium-2 (EGM™-2) Bulletkit™ (Lonza Bioscience) on pretreated tissue culture 6-well plate (VWR international) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)– 2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... Primary XP-C patient fibroblasts XP168LV were cultured at 37°C in an atmosphere of 5% CO2 in Ham’s F10 medium without thymidine (Lonza) supplemented with 20% fetal calf serum and antibiotics.
-
bioRxiv - Molecular Biology 2021Quote: ... were grown at 37°C (5 % CO2) in supplemented DMEM: Dulbecco’s Modified Eagle’s Medium with 4.5 % glucose (Lonza, Visp, Switzerland) supplemented with 10 % fetal bovine serum (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... Naive CD4+ T cells were cultured at 5% CO2/37°C in serum-free X-Vivo 15 medium (Lonza).
-
bioRxiv - Developmental Biology 2023Quote: ... were cultured at 37°C and 5% CO2 in EGMTM Endothelial Cell Growth Medium with BulletKitTM (Lonza CC-3124) and 1x antibiotic-antimycotic (Gibco ...
-
bioRxiv - Genomics 2023Quote: ... Cells were grown at 37°C and 5% CO2 and passed with Hepes buffered saline solution (Lonza, CC-5024) and 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: Primary human alveolar epithelial cells (HPAECs, CellBiologics) were cultured at 37°C and 5% CO2 with SABM medium (Lonza), SAGM supplements (Lonza) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2024Quote: Human HeLa cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Immunology 2022Quote: Cryopreserved PBMC (2-5 × 106/sample) were thawed in prewarmed RPMI-1640 with L-glutamine (Lonza) + 10% FCS ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 5 were isolated from human nonparenchymal liver cells (NPCs) purchased from Lonza (cat# HUCNP) as described previously (Chen et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Biochemistry 2023Quote: ... Briefly, D.mel-2 cells (CRL-1963, ATCC) were grown at 25°C in Insect-Xpress medium (181562, Lonza) supplemented with 1% Pen/Strep (15140122 ...
-
bioRxiv - Genetics 2023Quote: ... 2−106 lymphoblastoid cells were suspended in 100 μL of Nucleofector C solution (VCA-1004, Lonza Cologne AG) with 0.6 μM RNAi and transfected with the Z-001 program according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Cells were differentiating for 7 days in DMEM (Lonza) supplemented with 25% of L929 medium ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... NSCs were harvested with Accutase and 2-3×106 cells were resuspended in 100µl mouse neural stem cell nucleofector buffer (Lonza) with 2µg plasmid DNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Cell Biology 2022Quote: Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were maintained at 37°C and 5 % CO2 in a humidified atmosphere and routinely tested to be mycoplasma negative (MycoAlert Mycoplasma Detection Kit, Lonza). Cells were cultured no longer than 15 passages before experimental use.
-
bioRxiv - Cancer Biology 2019Quote: ... All cells were maintained in an incubator (37 C, 5% CO2) and checked routinely for mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza).