Labshake search
Citations for Lonza :
151 - 200 of 1594 citations for 7 16 DIHYDROBENZO A BENZO 5 6 QUINO 3 2 I ACRIDINE 9 18 DIONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Neuroscience 2022Quote: ... and protocol A- 23 with a Nucleofector I (Lonza). Both the transposase plasmid (2.75ug ...
-
bioRxiv - Molecular Biology 2023Quote: VSCMs were transfected in a Nucleofector I device (Lonza) using the Basic Nucleofector Kit for Primary Mammalian Smooth Muscle Cells (VPI-1004 ...
-
bioRxiv - Biochemistry 2023Quote: ... and performed electroporation with a Nucleofector I device (Lonza) using a preset program (X-001) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Microbiology 2023Quote: ... 6 mmol/L l-glutamine (Lonza®), and a mixture of penicillin/streptomycin (100U/100 μg/mL ...
-
bioRxiv - Cell Biology 2022Quote: COS-7 and U2OS cells were grown in DMEM (Lonza, 12-604F) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Bioengineering 2019Quote: ... MCF-7 cells were cultured in DMEM low glucose medium (Lonza, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested on day 7 with 1 X PBS EDTA (Lonza).
-
bioRxiv - Bioengineering 2023Quote: Primary human umbilical vein endothelial cells (HUVECs; Lonza; passages 4 to 7) were cultured on dishes in Endothelial Cell Growth Medium-2 (EGM-2 ...
-
bioRxiv - Immunology 2020Quote: ... in a 16-well Nucleocuvette Strip and the Amaxa 4D-Nucleofector X Unit (Lonza) running program EY-100 ...
-
bioRxiv - Immunology 2022Quote: ... Cells were electroporated in 16-well strips in a 4D Nucleofector X unit (Lonza) with program EH100 for human T cells ...
-
bioRxiv - Microbiology 2019Quote: ... All experiments were done with cells at passage 2 to 5 and cells were regularly checked for mycoplasma contamination (MicoAlert Lonza).
-
bioRxiv - Cell Biology 2019Quote: ... HUVE cells were cultured in endothelial growth medium supplemented with 5% fetal bovine serum (FBS) and growth factors (EGM-2; Lonza). HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Immunology 2021Quote: Human telomerase-immortalized corneal epithelial (hTCEpi) cells (26) were maintained at 37°C/5% CO2 in regular keratinocyte growth medium KGM-2 (Lonza). Prior to treatment ...
-
bioRxiv - Immunology 2021Quote: ... CD3/CD28 beads were removed 48 hours after stimulation and 5 × 106 CTLs were electroporated with 2 μg plasmid using 4D-Nucleofector (Lonza). Medium was changed 6 hours after nucleofection and transfected cells were used 24-36 hours after electroporation ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary MEC were cultured in endothelial growth media (EGM) containing 5% FBS with growth factors (EBM-2; Lonza, Basel, Switzerland) at 37°C in 5% CO2 ...
-
bioRxiv - Biochemistry 2021Quote: Plateable, cryopreserved primary human hepatocytes (pHep) from one male donor (18 years, BMI 28.7) were purchased from Lonza, Switzerland ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were maintained at 37°C in 5% CO2 in either EGM-2 MV complete media (CC-3125, Lonza, Walkersville, MD) or in M199 supplemented with 20% FBS (Atlanta Biologicals ...
-
bioRxiv - Bioengineering 2019Quote: ... Electroporation (Nucleofection) was performed using Lonza 4D 16-well Nucleocuvette™ Strips (Lonza, V4XP-3032). 6 μg of Cas9 (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2019Quote: ... Cells were then electroporated in 16-well strips in a 4D Nucleofector X unit (Lonza) with program EH-100 ...
-
bioRxiv - Microbiology 2021Quote: ... which was transferred to precooled (4 °C) well in a 16 well Nucleocuvette Strip (Lonza). Cells were nucleofected using the EH-100 program of Lonza’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells and COS-7 cells (ATCC) were cultured in DMEM medium (Lonza) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Immunology 2021Quote: ... density gradient centrifugation (20 min, 800g) and culture for 12-18 h in X-VIVO 10 TM medium (Lonza) supplemented with gentamicin ...
-
bioRxiv - Cell Biology 2022Quote: ... 1.5 μg ssODN and 1.2 μl 100 μM Alt-R Cas9 Electroporation Enhancer (IDT) were mixed and added to 20,000 cells resuspended in 18 μl SF Nucleofection Buffer (Lonza). Nucleofection mixture were transferred to 16-well Nucleocuvette strips (Lonza ...
-
bioRxiv - Bioengineering 2023Quote: ... with two phosphothiorate linkages on each end were mixed with 82 µL Nucleofector Solution V and 18 µL of Supplement Solution 1 according to manufacturer’s recommendations for the Cell Line Nucleofector Kit V (Lonza). 5×105 U2OS.EGFP parent cells were resuspended in the above mixture and nucleofected with a Lonza Nucleofector 2b Device (Kit V ...
-
bioRxiv - Genomics 2019Quote: ... The products were size selected on a 3% NuSieve 3:1 Agarose gel (Lonza), purified using NucleoSpin Gel and PCR clean-up columns ...
-
bioRxiv - Cell Biology 2022Quote: ... and CD31+Rspo3+ cells were centrifuged at 500 g for 5 min and resuspended in 500 μl endothelial cell media: EGM-2 MV Bullet Kit (Lonza, cc-3202) supplemented with 50 ng/mL VEGF-C (R&D ...
-
bioRxiv - Cell Biology 2024Quote: ... coated tissue culture polystyrene (TCPS) and maintained at 37° Celsius and 5% CO2 in endothelial growth medium (EGM-2 with bullet kit; Lonza, CC-3162) supplemented with 1% penicillin/streptomycin (Corning ...
-
bioRxiv - Neuroscience 2023Quote: ... containing ∼1000 neurons) was transferred to 9 mL of wash media (DMEM/F12 with penicillin/streptomycin [Lonza; Allendale, NJ]), then recovered by centrifugation (∼350 xG ...
-
bioRxiv - Immunology 2021Quote: ... and immediately electroporated using a Lonza Nucleofector I (Lonza, Basel, Switzerland) and program X-05 (X-005 on newer Nucleofector models) ...
-
bioRxiv - Bioengineering 2020Quote: ... and immediately electroporated using a Lonza Nucleofector I (Lonza, Basel, Switzerland) and program X-05 (X-005 on newer Nucleofector models) ...
-
bioRxiv - Immunology 2020Quote: ... Slices were collected and cultured overnight in 500 μL of “complete RPMI”: RPMI (Lonza, 16-167F) supplemented with 10% FBS (VWR ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were electroporated with Lonza 4D-Nucleofector™ in 16-well Nucleocuvette Strips (Lonza, V4XP-3032). Cas9 at 6µg (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... between 1 x 106 and 1 x 107 cells were resuspended in 18 μl of P3 primary cells solution (Lonza), 2 μl of the restricted cassette (2-4 μg total ...
-
bioRxiv - Neuroscience 2020Quote: Primary human cortical astrocytes purified from 17-18 weeks gestation human fetuses of indeterminate sexes were used in this experiment (Lonza). Astrocytes were expanded using the astrocyte growth medium bulletkit according to the manufacturer’s instructions at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Vero E6 cells with an average population of 104 cells were cultured for 18–24 h in each well in the growth medium [Eagle’s Minimum Essential Medium (EMEM) (Lonza Bioscience) +L serum (FBS ...
-
bioRxiv - Synthetic Biology 2022Quote: ... T cells were resuspended in P3 buffer (0.75-1 x 106 cells per 18 μl P3) from the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). 10 μg/μl Alt-R S.p ...
-
bioRxiv - Cancer Biology 2022Quote: ... An iCasp9-CD20/CD19-CAR transposon minicircle carrying CD20 scFv[17] and CD19 scFv[18] and a qPBase plasmid were delivered into activated T cells using 4D-Nucleofector device (Lonza) and Quantum Nufect Kit (GenomeFrontier Therapeutics ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were pelleted and resuspended in 100 μl of P3 transfection solution (82 μl Amaxa Buffer and 18 μl P3 supplement; Lonza) and 10 μl of DNA mix ...
-
bioRxiv - Bioengineering 2023Quote: ... in 6-well tissue culture plates and were allowed to adhere for 5 hours before induction of serum starvation in EBM-2 (LONZA, Cat# CC-3156) for 16 hours prior to being administered media of interest ...
-
bioRxiv - Microbiology 2020Quote: ... Integrity and purify of SyAMs were assessed by SDS-PAGE analysis using 8-16 % gradient gel (Lonza).
-
bioRxiv - Neuroscience 2022Quote: ... 8 wells were transfected using Amaxa nucleofection with P3 Primary Cell 4D-Nucleofector 16-well Strips (Lonza). Each well contained a single-cell suspension of 1.6 × 105 cells in 20 µl of Primary Cell P3 buffer with supplement (Lonza ...
-
bioRxiv - Molecular Biology 2020Quote: ... Days 16-24 media contained recombinant Oncostatin M (20ng/ml, Thermo) in HCM media lacking EGF (Lonza).
-
bioRxiv - Cell Biology 2020Quote: ... and electroporated with program X-01 on the Nucleofector I system (Lonza). Cells were used 48 h after siRNA treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... phosphodiester linkages in the DNA backbone were cleaved by DNAse I (Lonza).
-
bioRxiv - Microbiology 2020Quote: ... 0.1 µL of a 100 X stock of SYBR Green I (Lonza), and 500 U Hot Start Taq DNA Polymerase (New England Biolabs) ...
-
bioRxiv - Biophysics 2023Quote: Collagen type I hydrogels (RAFT Reagent Kit for 3D culture, Lonza, Basel) are prepared on ice to a final collagen concentrations of 1.0 mg/ml and polymerized at room temperature in a 96-well plate (200 μl volume per well ...
-
bioRxiv - Biophysics 2023Quote: Collagen type I hydrogels (RAFT Reagent Kit for 3D culture, Lonza, Basel) are prepared on ice to a final collagen concentration of 1.0 mg/ml ...