Labshake search
Citations for Lonza :
101 - 150 of 1594 citations for 7 16 DIHYDROBENZO A BENZO 5 6 QUINO 3 2 I ACRIDINE 9 18 DIONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... Nucleofection mixture were transferred to 16-well Nucleocuvette strips (Lonza) and nucleofected with the 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were transferred into 16-well nucleovette strips (Lonza). After 10 minutes at room temperature electroporation was performed on the Amaxa 4D Nucleofector (Lonza ...
-
bioRxiv - Immunology 2023Quote: ... and cells were nucleofected in 16-well Nucleocuvette strips (Lonza) using a 4D-Nucelofector® (Lonza).
-
bioRxiv - Neuroscience 2019Quote: ... a Nucleofector® I console (Lonza) was used to transfect DRG neurons ...
-
bioRxiv - Systems Biology 2020Quote: ... adding 0.5X SYBR green I (Lonza). Final volume of each reaction was 45ul ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... SYBR Green I (Lonza, Basel, Switzerland) was applied to the cultured cells before observations.
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 2mM Ultraglutamine I (Lonza), 10 mM HEPES (Gibco) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary uveal melanoma cells were equally divided onto two wells of a fibronectin-covered 6-well tissue culture plate and grown in 5% CO2 in MDMF medium which consists of HAM’s F12 (Lonza, Walkersville MD, USA) supplemented with 1 mg/mL BSA (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)– 2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: Cryopreserved PBMC (2-5 × 106/sample) were thawed in prewarmed RPMI-1640 with L-glutamine (Lonza) + 10% FCS ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 5 were isolated from human nonparenchymal liver cells (NPCs) purchased from Lonza (cat# HUCNP) as described previously (Chen et al. ...
-
bioRxiv - Immunology 2021Quote: ... Cells were differentiating for 7 days in DMEM (Lonza) supplemented with 25% of L929 medium ...
-
bioRxiv - Microbiology 2022Quote: ... and stained with 10 × SYBR Green I (SYBR® Green I Nucleic Acid Stain; Lonza, Rockland, ME, USA) in 1×TAE buffer for 3 min ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... pre-coated cell culture 6-well plate with EBM-2 endothelial media supplemented with 10% FBS and a growth factor bullet kit (Lonza, Walkersville, USA) 3 mL/well ...
-
bioRxiv - Cancer Biology 2019Quote: ... NSCs were harvested with Accutase and 2-3×106 cells were resuspended in 100µl mouse neural stem cell nucleofector buffer (Lonza) with 2µg plasmid DNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Molecular Biology 2021Quote: ... SYBR Green I (Lonza Cat no. 50513) or EvaGreen dye (Biotium Cat no ...
-
bioRxiv - Cell Biology 2019Quote: ... or the Amaxa Nucleofector I system (Lonza). For EPs with Neon Transfection System ...
-
bioRxiv - Bioengineering 2024Quote: ... The hUVEC cells were cultured and expanded until passage 5 with EGM-2 media (CC-3156, Lonza) and SingleQuot supplements (CC-4176 ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Biochemistry 2020Quote: COS-7 cells were cultured in 50/50 DMEM (Lonza)/Ham’s F10 (Lonza ...
-
bioRxiv - Developmental Biology 2019Quote: ... embryos were embedded in 7% low-melting point agarose (Lonza) and sagittal tissue sections at 100 µm thickness were cut on a VT1000S vibratome (Leica) ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleofections were carried out in a 16-well Nucleocuvette (Lonza #V4SP-3096) using an Amaxa Nucleofector (Lonza ...
-
bioRxiv - Synthetic Biology 2023Quote: ... K562 were electroporated in Amaxa solution (Lonza Nucleofector 2b, setting T0-16) with 1μg of reporter donor (pEF1a-p450-rapalog-split-TEVP-T2A-mCherry ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested to be negative for mycoplasma every 2–3 months using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Genetics 2020Quote: ... hESCs were nucleofected with 2 μg of CRISPR and 3 μl ssODN (100 μm) using the P3 Primary Cell Kit L (Lonza). hESCs were then plated onto puromycin-resistant (DR4 ...
-
bioRxiv - Genomics 2023Quote: ... Both vectors were also transfected as background controls (1 µg) with pmaxGFP (9 µg, Lonza). 24 hours post nucleofection ...
-
bioRxiv - Cell Biology 2020Quote: ... U–2–OS-pEP15 cells (5) were maintained in 1 mg/ml glucose phenol-red-free DMEM (Lonza) supplemented with steroid-free FBS (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2023Quote: ... USA) were cultured in 5% fetal bovine serum containing endothelial cell growth medium (EGM-2; Lonza, Basel, Switzerland). Media was supplemented with heparin ...
-
bioRxiv - Cancer Biology 2024Quote: ... and nucleofected with an Amaxa Nucleofector I (Lonza) using program C-13 for PHGGs or T-20 for astrocytes ...
-
bioRxiv - Cell Biology 2023Quote: ... Electroporation was achieved by Nucleofector I (AMAXA/Lonza) using program O-05 (Mouse CNS neurons) ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Bioengineering 2024Quote: The hMSCs were isolated from human bone marrow aspirate (Lonza; donor = 18-year-old black female) and serial expanded following previously described protocols[44] ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Bioengineering 2019Quote: ... The plate containing the amplified genes or qPCR products was kept in ice and observed in a 2% agarose gel (NuSieve® 3:1 Agarose (Lonza)) to check and reinforce the identity of the amplicons ...
-
bioRxiv - Physiology 2022Quote: ... Transient transfections with the plasmid dynamin I K44A-EGFP (a dynamin-I GTPase-defective dominant-negative mutant) were performed using a Nucleofector 4D device (Lonza, Switzerland), according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... Cells were harvested on day 7 with 1X PBS EDTA (Lonza).
-
bioRxiv - Molecular Biology 2019Quote: ... transferred to a well of a 16-well Nucleocuvette Strip (Lonza, V4XP-3032) and electroporated using the CM-113 program on the Amaxa 4D Nucleofector (Lonza) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and transferred into a 16-well nucleocuvette strip (Lonza, cat. no. V4XP-3032). For negative control ...
-
bioRxiv - Cancer Biology 2024Quote: ... 111906)16 using the P1 Primary Cell 4D-Nucleofector X kit (Lonza, V4XP-1032) and selected by keeping them in culture under hygromycin (Applichem ...
-
bioRxiv - Immunology 2024Quote: ... The cell mixture was then loaded into the 16-well nucleofection strips (Lonza) and electroporated by pulse code DS150 ...
-
bioRxiv - Biochemistry 2022Quote: ... Exponentially growing Spodoptera frugiperda 9 cells (2E06 cells/mL in Lonza Insect-XPRESS medium #BELN12-730Q) were infected with high-titer Baculovirus suspension ...
-
bioRxiv - Microbiology 2021Quote: ... HXGPRT amplicon (2-5 µg) into 1x106 RH TIR1-3FLAG tachyzoites in P3 buffer using a 4D-nucleofector (Lonza) with pulse code FI-158 ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with 25μL of SEC fractions 1 to 5 diluted 1:2 with PBS (Cat. No. LZBE17-512F, Lonza). Wells were washed with 0.05% Tween-20 (Cat ...