Labshake search
Citations for Lonza :
151 - 200 of 2027 citations for 4 1 1 2 3 3 3 Hexafluoropropoxy acetophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and diseased COPD human lung fibroblasts (DHLFs) from 3 donors (donor IDs: OF3353, OF3418 and OF3238) were purchased from Lonza and tested for their response to FGF2 and TGFβ stimulation.
-
bioRxiv - Cancer Biology 2022Quote: ... and then combined with 3 µL of RNP mixture and nucleofected using program DJ-110 (melanoma) or EH100 (TILs) on a 4D Nucleofector (Lonza). Melanoma cells were immediately recovered in full melanoma media in 12-well plates ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza, Basel, Switzerland) supplemented with 10% FBS ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza, V4XP-3012) and the CA-137 program ...
-
bioRxiv - Bioengineering 2023Quote: Ha deposition was detected staining constructs sections (n≥10 from n≥3 chambers considering two different hACs and two different MSCs donors) with OsteoImage (Lonza) as detailed above ...
-
bioRxiv - Molecular Biology 2024Quote: ... The constructs were then transfected into WT OSCs and Δl(3)mbt-OSCs with Nucleofector Kit V (Lonza, VVCA-1003) using T-029 program and a NucleofectorTM 2b Device (Lonza) ...
-
bioRxiv - Microbiology 2024Quote: ... P.berghei schizonts were electroporated with 3 mg of each plasmid using the FI115 program on the Amaxa Nucleofector 4D (Lonza). Transfected parasites were promptly injected intravenously into BALB/c mice and were subjected to selection with 0.07 mg/mL of pyrimethamine in drinking water starting from day one post-infection ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... 3 x 106 freshly isolated monocytes or BMDMs were resuspended in 20 µl of P3 primary cell nucleofection buffer (Lonza). Cells were then added to the Cas9-RNP complexes ...
-
bioRxiv - Cancer Biology 2024Quote: ... were annealed to Cas9 protein (IDT) and the ribonucleoprotein complex was transfected into SKOV-3 cells using a 4D-Nucleofector (Lonza). Bulk transfected cells were checked by flow cytometry for successful knock-down ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR products were then loaded and migrated by electrophoresis on a 3% Tris-borate-EDTA (TBE) agarose gel supplemented with GelStar Nucleic Acid Gel Stain (Lonza) for approximately one hour ...
-
bioRxiv - Physiology 2024Quote: ... counted and 3.106 cells resuspended in 100 μl Nucleofactor R solution and electroporated with 3 µg of plasmid (pcDNA3 containing or not α7-5HT3 cDNA) using the Amaxa nucleofactor kit R (Lonza) according to the manufacturer instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3×106 live cells were resuspended with the RNP complex and 20 µL of P3 Primary Cell Nucleofector Solution (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... dissociated into single cell suspension with trypsin-EDTA (Pan-Biotech, Germany) for 3 min followed by trypsin neutralizing solution (Lonza, Germany). Single cell suspensions of secondary mammospheres were obtained as described for day 7-first generation mammospheres.
-
bioRxiv - Immunology 2022Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Supplementary Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... Slices were immediately placed in a 6-well plate containing 3 mL per well of “complete RPMI”: RPMI (Lonza, 16-167F) supplemented with 10 % FBS (VWR ...
-
bioRxiv - Molecular Biology 2024Quote: ... All cell lines were confirmed to be mycoplasma negative every 3 weeks (MycoAlert™ Mycoplasma Detection Kit, Lonza, Bend, OR, USA). Fifteen micrograms of total whole cell lysates (WCL ...
-
bioRxiv - Immunology 2024Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Extended Data Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were cultured at passage 3 and seeded in triplicate in hMSC Growth Medium (MSCGM™ Mesenchymal Stem Cell Growth Medium, Lonza) with 10% FBS ...
-
bioRxiv - Genetics 2023Quote: ... The RNP complex together with 7 µg of donor DNA was nucleofected into 3 × 107 ISE6 cells using EN150 and buffer SF via the 4D-Nucleofector system (Lonza Bioscience) (Figure S1) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza, Switzerland) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lines are cultivated at 37°C with 5% CO2 and were tested every 3 months for mycoplasma contamination using Universal Mycoplasma detection kit (ATCC, 30-1012K) or MycoAlert Plus Mycoplasma Detection Ki (Lonza, LT07-701). Cell lines were used no more than 30 passages.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A high resistance Plastiape® RS00 inhaler (Plastiape S.p.A, Osnago, Italy) containing size #3 HPMC capsules (V-Caps® Plus, Lonza, Morristown, NJ) and 1-3 mg of powder was attached to a USP induction port by a molded silicon adapter ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were seeded onto 96-well plates at a density of 3×104 cells per well in 100 μL cell culture media that consisted of DMEM (Lonza, Basel, Switzerland), 1% penicillin–streptomycin (Lonza ...
-
bioRxiv - Genomics 2024Quote: ... and electroporated with 6 μg of gRNA-Cas9 expression vector and 3 μg of SNRPN targeting vector using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3032). Transfected cells were plated into a 10 cm dish coated with Matrigel (Corning ...
-
bioRxiv - Microbiology 2023Quote: ... Full-thickness samples were obtained by 12 mm punch and placed in 12-well plates containing 3 mL Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, Walkersville, MD, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... A total of 3 × 106 cells were centrifuged and nucleofected using the P3 Primary Cell 4D-Nu-cleofector X Kit L (Lonza, V4XP-3024), a 4D-nucleofector core unit ...
-
bioRxiv - Bioengineering 2024Quote: ... 1,000,000 NIH/3T3 cells were centrifuged (200× g, 3 minutes) and resuspended in 100 µl of the SG Cell Line nucleofection Kit (Lonza, V4XC-3024). After the addition of 500 ng plasmid DNA encoding the hyperactive PiggyBac transposase and 1000 ng of the NTVE knock-in plasmid ...
-
bioRxiv - Immunology 2020Quote: ... diluted 1:100 in EBM-2 (Lonza). Cells were used for experiments within 3-5 passages ...
-
bioRxiv - Bioengineering 2024Quote: ... The mixture was transferred to a confocal plate and subsequently UV crosslinked at 15 mW/cm2 for 1 minute and cultured for 4 days in EGM-2 media (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 11 mM glucose and 25 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) pH 7.4 (Lonza, Basel, Switzerland). The apical (AP ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested EBs were transferred to a tissue-culture treated 6-well plate (Falcon, #353224) in 3 ml of EB Differentiation media: X-VIVO 15 (Lonza Biosciences, #04-418Q) + 1% Glutamax (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... cells were overlaid with 1:1 mixture of 2% agarose (Lonza, Basel, Switzerland) and 2X MEM medium ...
-
bioRxiv - Genetics 2021Quote: Human embryonic microglia clone 3 (HMC3, ATCC® CRL3304™) cells were cultured in minimum essential medium (MEM) Eagle-EBSS with NEAA without L-Glutamine (Lonza, Cologne, Germany) supplemented with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: About three milligrams of AUG-3387 mAb dry powder was loaded into size #3 hydroxypropyl methylcellulose (HPMC) capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Genomics 2022Quote: ... 1.0µg/µl SpCas9-sgRNA-PGK-Venus construct and 1µg/µl donor construct were nucleofected into ∼3×106 Tir1 mESCs using the Amaxa™ 4D-Nucleofector and the P3 Primary Cell 4D-Nucleofector™ X Kit (Lonza, Cat. V4XP-3024) following the manufacture’s protocol ...
-
Measuring adaptation dynamics to hydrogen peroxide in single human cells using fluorescent reportersbioRxiv - Cell Biology 2020Quote: ... 1% L-glutamine (2 mM) and 1% (v/v) penicillin-streptomycin (100 IU/ml) (Lonza). Cell cultures are maintained at 37°C in a humidified atmosphere containing 5 % CO2 (v/v) ...
-
bioRxiv - Cell Biology 2024Quote: ... These cells are mantained in 30% FBS/1% antibiotic/antimycotic /1% Non-essential AA/ EGM-2 media (Lonza) with Laminin521 coating (5 μg/ml ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were split at a 1:2 ratio every 2 days by trypsinization (Lonza cat# CC-5012), followed by centrifugation at 200 x g for 3 min before resuspending and reseeding in EBM Basal Medium supplemented with the EGM Singlequots Supplement Pack ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with 25μL of SEC fractions 1 to 5 diluted 1:2 with PBS (Cat. No. LZBE17-512F, Lonza). Wells were washed with 0.05% Tween-20 (Cat ...
-
bioRxiv - Bioengineering 2020Quote: ... The cell suspension contained a 2:1 ratio of GFP-HUVECs (Lonza) and HDFs ...
-
bioRxiv - Cell Biology 2022Quote: ... BUB-1 and CLS-2::GFP production was performed in 2 L SF9 cells in Insect-XPRESS (Lonza) medium (1×10^6 cells/mL) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and E15.5 (n=2–6) Six2-TROMA-1 stained kidneys were embedded in 1 % low melting agar (50100; Lonza Group). The lateral cortex of the kidneys was imaged with a Nikon A1R MP+ multiphoton microscope (Tokyo ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×10E6 ME-1 cells were nucleofected with CRISPR/Cas9 plasmids (2 μg each) using Nucleofector Technology (Lonza Biologics) with the program X-01 and Amaxa Cell Line Nucleofector Kit V ...