Labshake search
Citations for Lonza :
1701 - 1750 of 2167 citations for 1 5 Bis 2 2 methyl 1 oxoallyl oxy ethyl dihydrogen benzene 1 2 4 5 tetracarboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cells were maintained at 37°C and 5% CO2 and 95% relative humidity and regularly tested negative for mycoplasma infection by Mycoalert detection kit (Lonza). For 3D growth conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... Two million E14 ESCs were nucleofected with paired Kdm3b targeting and donor plasmids (5 µg each) using the Amaxa 4D-Nucleofector protocol (Lonza) and selected with blasticidin S hydrochloride (Research Products International ...
-
bioRxiv - Cell Biology 2024Quote: ... serum-starved RPE1 cells where trypsinized and 0.5×106 of the cells were resuspended in 20 μl of the P3 Primary Cell 4D-Nucleofector Kit buffer (Lonza). The cell suspension was then nucleoporated with reporter plasmids with DNA lesions and undamaged control plasmids ...
-
bioRxiv - Bioengineering 2023Quote: ... Both cell lines were maintained in an incubator at 37 °C and 5% CO2 and tested for Mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza) regularly.
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were maintained at 37°C in 5% CO2 and frequently examined for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2023Quote: NIH/3T3 fibroblasts were cultured at 37 °C and 5% CO2 in low-glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Lonza, Basel, Switzerland) and 1% penicillin/streptomycin antibiotic ...
-
bioRxiv - Physiology 2024Quote: ... of six genetically independent donors were grown as monolayers in 100% humidity and 5% CO2 at 37 1C in serum-free defined growth media (BEGM, Lonza). NHBEs (passage 3 ...
-
bioRxiv - Immunology 2022Quote: ... Cryopreserved PBMC (5 x 106/sample) were thawed in prewarmed RPMI-1640 media supplemented with L-glutamine (Lonza, Basel, Switzerland) + 10% FCS ...
-
bioRxiv - Cell Biology 2024Quote: ... prepared in tris-acetate (40 mM)/EDTA (10 mM) buffer and 5 μl of GelStar Nucleic Acid Stain 10,000 x (Lonza, 50535). 20 μl per sample resulting from PCR were mixed with Blue/Orange loading buffer loading dye 6x (PROMEGA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were maintained at 37 °C in a humidified atmosphere containing 5% carbon dioxide (CO2) and were tested for mycoplasma contamination using MycoAlert Mycoplasma detection kit (Lonza).
-
bioRxiv - Molecular Biology 2024Quote: All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza). Human primary hepatic stellate cells used for the main experiments were from Lonza (HUCLS ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 and tested negative for mycoplasma contamination by MycoAlert mycoplasma detection kit (Lonza). Expression of doxycycline-inducible shRNA was induced by supplementing media with 0.1-1 µg/ml doxycycline for 6 days ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were grown at 37°C in a humidified incubator with 5% CO2 and were regularly performed mycoplasma test using a MycoAlert Mycoplasma Detection kit (Lonza). Cells with mycoplasma-free were used for experiments.
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were maintained at 37 °C in a 5% CO2 humidified atmosphere and regularly screened for the presence of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza). Cell lines were cultured for no more than 20 passages following thawing ...
-
bioRxiv - Biochemistry 2024Quote: ... All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza).
-
bioRxiv - Cancer Biology 2021Quote: ... Drug solutions were removed and wells washed twice with 1 x phosphate buffered saline (PBS; Lonza). Fresh Complete
-
bioRxiv - Genomics 2020Quote: ... G8PPD-coding plasmid (1 μg) was mixed with re-suspended K562 cells and nucleofected by Lonza 4D nucleofector with program FF-120 ...
-
bioRxiv - Immunology 2020Quote: ... and CD59 (deficient HAP-1 cells) (21) were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM; Lonza) supplemented with 10% (v/v ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Horizontal electrophoresis of DNA was carried out using 1% Seakem LE agarose gels (Lonza, Basel, Switzerland). All cloning and molecular biology experiments were carried out according to established protocols ...
-
bioRxiv - Bioengineering 2020Quote: Liver-Chips were stained in the upper channel with AdipoRed (1:40 dilution in PBS, Lonza) to visualize lipid droplet accumulation ...
-
bioRxiv - Immunology 2022Quote: ... 1 × 106 cells were transfected with 8 μg ScaI-linearized plasmid using the Amaxa Nucleofector (Lonza) SF kit on program DS-113 ...
-
bioRxiv - Microbiology 2021Quote: ... as well as the standard LdBPK_282 cl4 using the Basic Parasite Nucleofector™ Kit 1 (Lonza) with the U-033 program ...
-
bioRxiv - Synthetic Biology 2020Quote: ... then embedded in a lateral orientation in 1% low melting point agarose (NuSieve GTG agarose, Lonza), and allowed to polymerize in with cover glass (no ...
-
bioRxiv - Microbiology 2020Quote: ... Chromosomes were separated by pulsed-field electrophoresis for 260 hours in 1% Seakem Gold agarose (Lonza) at 1.5 V/cm in a CHEF-DRII system (Biorad ...
-
bioRxiv - Developmental Biology 2021Quote: VEGF treatment of HdLECs: Confluent HdLEC monolayers were starved overnight in 1% FBS in EBM2 (Lonza) or in human endothelial SFM (Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... 2μl of this was then used to transfect 1×106 promastigotes using a 4D nucleofector (Lonza). Parasites used for transfections were ...
-
bioRxiv - Bioengineering 2023Quote: ... Electroporation in Hepa 1-6 cells was carried out with a 4D Nucleofector X Unit (Lonza) using the CM-138 program as described in (34) ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: HM-1 ES cells were transfected with the resulting vector using a Nucleofector®-4D (Lonza) with the P3 Primary Cell X kit (Lonza ...
-
bioRxiv - Molecular Biology 2022Quote: ... ASO (20 µM) was delivered into cells (1 × 106) by electroporation in a Nucleofector device (Lonza) using the Amaxa Cell Line Nucleofector Kit V (Lonza #VCA-1003 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The human monocyte THP-1 cells were cultured in RPMI 1640 media from Lonza (NSW, Australia), containing 4.5 g/L D-glucose and supplemented with 2 mM GlutaMax ...
-
Starvation resistant cavefish reveal conserved mechanisms of starvation-induced hepatic lipotoxicitybioRxiv - Cell Biology 2024Quote: ... and mounted in 1% Low-Melt Agarose containing 0.02% Tricaine MS-222 (50080; Lonza, Basel, Switzerland) and imaged on a glass-bottomed FluoroDish (FD3510-100 ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 10% FBS and 1% antibiotic-antimycotic and endothelial cell growth supplement (#CC-4176, Lonza) to 80% confluency before passaging (up to passage number 8) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were plated on 1% gelatin-coated plates and maintained in plating medium [68% DMEM (Lonza), 17% 199 (Sigma) ...
-
bioRxiv - Physiology 2022Quote: ... Cleared lysates were loaded into wells of the SDS-agarose gels (1% SeaKem Gold Agarose [Lonza, Basel ...
-
bioRxiv - Microbiology 2022Quote: ... Human bronchial epithelial cells (NuLi-1) were cultured as previously described (19) in BEGM (Lonza, USA) with 1.15 mM calcium chloride and maintained as for hTCEpi ...
-
bioRxiv - Genomics 2023Quote: ... The gDNA integrity was evaluated with pulsed-field gel electrophoresis SeaKem® GOLD Agarose 1% (Lonza), using the Pippin Pulse (Sage Science) ...
-
bioRxiv - Developmental Biology 2024Quote: ... at 1:50 dilution and cultured in a mixture of endothelial cell growth medium (EGM, Lonza) and hepatocyte culture media (HCM ...
-
bioRxiv - Immunology 2024Quote: ... THP-1 cells (Cat#TIB-202, ATCC) were cultured in Roswell Park Memorial Institute (RPMI, Lonza) supplemented with 20% FBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼300 pairs of ovaries were dissected from 3-6 day old females in 1× PBS (Lonza) with 1 mM DTT (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 × 103 cells were plated in low-attachment 96-well plates containing 100 μL MEGM media (without BPE) (Lonza, CC-3150), 20 ng/mL bFGF (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: Cell lines were cultured according to standard aseptic mammalian tissue culture protocols in 5% CO2 at 37 °C with regular testing for mycoplasma contamination using the MycoAlert™ Mycoplasma Detection Kit (Lonza). HCT 116 ...
-
bioRxiv - Molecular Biology 2022Quote: HeLa cervical carcinoma cells were grown under a humidified 5% CO2 atmosphere at 37°C in Dulbecco’s modified Eagle’s medium (DMEM, Lonza, Alpharetta, GA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and immortalized human Brain Microvascular Endothelial cells (HBMEC) were seeded at 5000 cells/cm2 in EBM supplemented with 5% FBS and EGM supplements (all products, Lonza Bioscience) until reaching confluence 42,43 ...
-
bioRxiv - Neuroscience 2022Quote: ... cellular ATP content was measured two-three times a week between 5-7.5 weeks post transduction using the ViaLight Plus kit (Lonza, LT07-221) or ATPlite kit (PerkinElmer ...
-
bioRxiv - Immunology 2021Quote: ... were washed in PBS/0.5%BSA and resuspended in 100 µl Nucleofector solution (Amaxa™ P3 Primary Cell 4D Nucleofector TM X Kit L, Lonza) with 4-6 µl of the appropriate siRNA (20-40 µM ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RBD-Fc stable clone was obtained by electroporation with 2×106 cells and 5 μg endotoxin-free plasmids using Amaxa kit V and program U24 with Amaxa Nucleofector 2B (Lonza, Switzerland). Electroporated cells were subsequently plated in 96-wells at 500 cells/well in Plating Medium containing 80% EX CELL® CHO Cloning Medium (Cat.no C6366 ...
-
bioRxiv - Molecular Biology 2022Quote: ... collected by centrifugation at 500xg for 5 min and resuspended in SF solution (SF cell line 4D-Nucleofector™ X Kit, Lonza). After addition of the RNP ...
-
bioRxiv - Biophysics 2023Quote: ... 1.5mL for a T75 flask for 5 minutes at 37° C and resuspended in 80 μL of SF cell line solution (Lonza; Basel) per flask ...
-
bioRxiv - Physiology 2022Quote: ... 1 million cells were washed with PBS and electroporated with 5-10 μg of appropriate plasmid using Amaxa cell nucleofector kit T (Lonza laboratories). Cells were allowed to recover for 48 h ...