Labshake search
Citations for Lonza :
1601 - 1650 of 2167 citations for 1 5 Bis 2 2 methyl 1 oxoallyl oxy ethyl dihydrogen benzene 1 2 4 5 tetracarboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (P/S, Lonza). For both cell types ...
-
bioRxiv - Developmental Biology 2023Quote: ... and were separated by electrophoresis in 1-1.2% (w/v) agarose gel (Lonza 50004) supplemented with 0.03μl/ml DNA staining dye (Serva ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 12.5% fetal bovine serum (FBS) and 1% penicillin-streptomycin (P/S, Lonza). Human SH-SY5Y neuroblastoma cells (ATCC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Obtained spheroplasts were next embedded into 1 % low melting agarose (InCert Agarose 50123, Lonza) plugs and incubated overnight at 55 °C in a digestion buffer with 1 mg/mL of proteinase K (Euromedex EU0090) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 × 106 iPSCs were resuspended in 100 μl of P3 buffer (V4XP-3024, Lonza) containing 20 μg Alt-R® S.p ...
-
bioRxiv - Microbiology 2024Quote: ... An agarose pad was made of 1% SeaKem LE Agarose (Lonza, Cat. No. 50000) in dH2O ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary XP-C patient fibroblasts XP168LV were cultured at 37°C in an atmosphere of 5% CO2 in Ham’s F10 medium without thymidine (Lonza) supplemented with 20% fetal calf serum and antibiotics.
-
bioRxiv - Molecular Biology 2021Quote: ... were grown at 37°C (5 % CO2) in supplemented DMEM: Dulbecco’s Modified Eagle’s Medium with 4.5 % glucose (Lonza, Visp, Switzerland) supplemented with 10 % fetal bovine serum (Gibco ...
-
bioRxiv - Genomics 2020Quote: ... and 5×104 cells were resuspended in 20 μL SF electroporation buffer prepared with SF supplement (Lonza, Basel, Switzerland). 3 μL RNP complex solution was mixed with the cells and the cells were nucleofected using program DJ-110 on a 4D-Nucleofector (Lonza ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 × 106 of EGFP-PGCs were resuspended in a total volume of 100 μl Nucleofector Solution V (Lonza, Switzerland) premixed with 10 μg of Cas9 plasmid and the same amount of phiC31 integrase ...
-
bioRxiv - Genetics 2020Quote: ... 5μg vector (in 5μl) transfected into 5 million CD4 T cells in 100μl 1M nucleofection solution67) using a Nucleofector 2b device (Lonza; program V024 for resting T cells and T023 for stimulated T cells) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5×106 EL16.7 TST ESCs were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001) using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’ ...
-
bioRxiv - Cell Biology 2021Quote: Whole-mount Drosophila ovary samples (approximately 5 flies per experiment) were dissected into Grace’s insect media (Lonza, Walkersville, MD) and fixed for 10 minutes at room temperature in 4% paraformaldehyde in Grace’s insect media ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 μg of DNA was used to transfect the cells using the Amaxa Cell Line Nucleofector kit (Lonza Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Microbiology 2021Quote: ... was adjusted to OD600 of 2.5 (2.2 × 109 bacteria/mL) and the bacteria were then further diluted in serum-free XVIVO-15 medium (Lonza) prior to infection to obtain the respective multiplicity of infection (MOI) ...
-
bioRxiv - Immunology 2021Quote: ... Naive CD4+ T cells were cultured at 5% CO2/37°C in serum-free X-Vivo 15 medium (Lonza).
-
bioRxiv - Microbiology 2021Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Microbiology 2022Quote: ... and the well was gently washed once with 5 mL of phosphate buffered saline (PBS, Lonza, Rockland, ME, USA) to remove un-adherent floating bacteria ...
-
bioRxiv - Microbiology 2022Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Cancer Biology 2024Quote: ... Red blood cell lysis was performed for 5 min at room temperature in ACK lysing buffer (Lonza, #10-548E). For flow cytometry ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Biochemistry 2023Quote: Plasma cholesterol was depleted by treating HEK293 cells with 5 mM MβCD for 30 min in Pro293A-CDM (Lonza); this short period of MβCD treatment was deemed sufficient to removed 50% of endogenous cholesterol from cells (34) ...
-
bioRxiv - Biochemistry 2024Quote: Human HeLa cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP were formed by mixing 5 to 9 μgr base editor protein with 1.5 μgr of sgRNA in 20 μL of P3 buffer (Lonza, Amaxa P3 Primary Cell 4D-Nucleofector Kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were pelleted at 1000 rpm for 5 min and resuspended in 100 μL nucleofector solution (Lonza, #VPB-1002) before adding 2.5 μg of plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... were cultured at 37°C and 5% CO2 in EGMTM Endothelial Cell Growth Medium with BulletKitTM (Lonza CC-3124) and 1x antibiotic-antimycotic (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... Cas9-gRNA ribonucleoproteins were assembled as described previously53 and nucleofected into 5×106 monocytes in 100μL nucleofection buffer (Human Monocyte Nucleofection Kit, Lonza) using a Nucleofector 2b (Lonza ...
-
bioRxiv - Genomics 2023Quote: ... Cells were grown at 37°C and 5% CO2 and passed with Hepes buffered saline solution (Lonza, CC-5024) and 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: Primary human alveolar epithelial cells (HPAECs, CellBiologics) were cultured at 37°C and 5% CO2 with SABM medium (Lonza), SAGM supplements (Lonza) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Biochemistry 2024Quote: Human lung carcinoma A549 cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cell Biology 2024Quote: Primary human mammary epithelial cells (HMECs) were cultured at 37°C with 5% CO2 in MEBM basal medium (Lonza) supplemented with MEGM SingleQuots (Lonza ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells in passage 1 were trypsinized and resuspended (3 × 104 cells/mL) in BEGM** (Lonza, see Table S4 for details of media composition ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... 1 μg plasmid DNA was added and cells electroporated in a 4D-NucleofectorTM System (Lonza) following the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2020Quote: ... and the injury site was covered completely with a layer of 1% sterile SeaKem (Lonza) agarose ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1×106 Primary Human T cells were electroporated using the 4D-nucleofector (Lonza, Basel, Switzerland) and a P3 Primary Cell 4D-Nucleofector™ X Kit (V4XP-3032) ...
-
bioRxiv - Cell Biology 2021Quote: Astrocytes were transfected with siRNAs (1-5nM) or plasmids (5µg) using a Nucleofector machine (Lonza) and the appropriate Lonza glial cell nucleofector solution ...
-
bioRxiv - Immunology 2021Quote: ... . THP-1 cells were transfected with the plasmid using the Amaxa Nucleofector 2b device (Lonza) and the Human Monocyte Nucleofector Kit (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... Murine L929 cells (ATCC CCL-1) were maintained in Eagle’s minimal essential medium (MEM) (Lonza) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... We used the Human Stem Cell Nucleofector Kit-1 and a Nucleofector 2b Device (Lonza) to transfect the plasmids and oligonucleotide donor DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... placed on Lo-Flo SD + 1% agarose pad (SeaKem ® Gold Agarose, Lonza, Rockland, ME) supplemented with 15 μg/mL nocodazole and 1 mM auxin ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were resuspended in P3 Primary Cell Nucleofector™ Solution containing Supplement 1 (Lonza, Switzerland) and 1 µg of chemically modified sgRNA (Synthego ...
-
bioRxiv - Microbiology 2021Quote: ... 1% 10 mM HEPES in 0.85% NaCl (17-737E, Lonza, BioWhittaker®, Walkersville, MD, USA) and 100 U/ml Penicillin-100 µg/ml Streptomycin (15140-122 ...
-
bioRxiv - Genomics 2021Quote: ... 100 units of potassium penicillin and 100 μg of streptomycin sulfate per 1 ml (Lonza). Four and eight T75 cell culture flasks were used for the ERS2312967 and ERS1870077 samples ...
-
bioRxiv - Immunology 2020Quote: ... Cells were resuspended at 1×106 cells/ml in XH media (X-Vivo 15 (Lonza) with 5% human serum ...
-
bioRxiv - Immunology 2021Quote: ... 1% penicillin-streptomycin (penicillin 50 U/ml and streptomycin 50 μg/ml, final concentration; Lonza) at 37 °C with 5% CO2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 million hESCs were resuspended with 100uL Lonza Amaxa P3 nucleofection solution (Lonza V4XP-3024), the annealed ...
-
bioRxiv - Immunology 2022Quote: ... For larger scale electroporation in the 1 ml scale of Nucleocuvette Cartridge (Lonza, V4LN-7002), reactions were scaled up 10 fold for cell suspension ...