Labshake search
Citations for Lonza :
1601 - 1650 of 4565 citations for Primary Human Retinal Microvascular Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... siRNA transfection in primary melanocytes was done using Nucleofection Kit (Lonza, VPD-1003, U-024 program) (Sultan et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The commercially available human myoblasts isolated from the healthy subject (CC-2580; Lonza, MD, USA) were maintained in Skeletal Muscle Growth Media-2 (CC-3245 ...
-
bioRxiv - Cell Biology 2021Quote: The commercially available human myoblast stock isolated from healthy subject (CC-2580; Lonza, MD, USA) was used [14–16,18] ...
-
bioRxiv - Neuroscience 2020Quote: ... fresh human foetal brain tissue was chopped mechanically and dissociated with Trypsin (LONZA; BE17-161E) 1:5 in growth medium for 5-10 min at 37°C ...
-
bioRxiv - Pathology 2019Quote: Human aortic SMCs and ECs and their respective medium were purchased from Lonza (Walkersville, MD). BrdU ELISA colorimetric kit was purchased from Roche-Sigma Aldrich (Indianapolis ...
-
bioRxiv - Molecular Biology 2023Quote: ... Different batches of human dermal fibroblasts used as control (pDF) were bought from Lonza (adult) and Zen-bio (papillary and reticular ...
-
bioRxiv - Cell Biology 2023Quote: Human ESCs were nucleofected using an Amaxa nucleofector II in Nucleofector Solution L (all Lonza) using B-016 preset ...
-
bioRxiv - Genetics 2023Quote: ... to control for transfection efficiency) using the Human Macrophage Nucleofector kit (Amaxa, Lonza, Portsmouth, NH). After 24 hours cells were treated with 50 ug/ml ox-LDL or buffer for a further 24 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... and human normal dermal fibroblasts (NDFs; cat # CC-2511) were purchased from Lonza (Walkersville, MD). Human THP1 monocytes (cat # TIB-202) ...
-
bioRxiv - Biophysics 2019Quote: ... Approximately 1 to 1.5 × 106 hPSCs were washed in DPBS and resuspended in P3 primary buffer (Lonza) with 1 μg gRNA ...
-
bioRxiv - Cell Biology 2020Quote: BMMs were cultured for 48 hours in the OsteoAssay™ Human Bone Plate (Lonza, Walkersville, MD) coated with a thin layer of adherent human bone particles in complete medium containing 25 ng/ml MCSF and PPi (100-1000 μM) ...
-
bioRxiv - Biophysics 2022Quote: Human adult bone marrow-derived MSCs (bm-MSCs) from 5 different donors were purchased from Lonza and StemCell Technology ...
-
bioRxiv - Physiology 2020Quote: ... Adult normal human dermal fibroblasts (NHDF) were cultured in FGM-2 fibroblast growth medium-2 (Lonza) at 37°C with 3% O2 and 5% CO2.
-
bioRxiv - Microbiology 2019Quote: ... cat #D-001206-13-05) using the Human Dermal Fibroblast NucleofectorTM Kit (Lonza, cat #VPD-1001). β-catenin expression was assayed 3 days later by Q-PCR.
-
bioRxiv - Immunology 2020Quote: ... Human ventricular cardiac fibroblasts that were harvested from normal adult ventricular tissue were obtained from Lonza, maintained at low passage number (<12) ...
-
bioRxiv - Neuroscience 2022Quote: ... Antibodies were validated with Western blot analysis using protein from Neuronal Human Astrocytes (Lonza, CC-2565) as previously reported in Knight and Serrano (2017a).
-
bioRxiv - Bioengineering 2024Quote: The hMSCs were isolated from human bone marrow aspirate (Lonza; donor = 18-year-old black female) and serial expanded following previously described protocols[44] ...
-
bioRxiv - Bioengineering 2021Quote: Human bone marrow-derived MSCs were obtained from 4 different donors purchased from Lonza (Walkersville, MD, USA), AllCells (Emeryville ...
-
bioRxiv - Neuroscience 2020Quote: ... Me49-Luc tachyzoites were maintained in vitro in monolayers of Normal Human Dermal Fibroblasts-Neonatal (NHDF, Lonza; kindly provided by Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Human CD34+ nucleofector kit and the Nucleofector II device (both from Lonza Group Ltd., CH) following manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 100 μg/ml streptomycin and 15 ng/ml recombinant human macrophage colony stimulating factor (Lonza, Melbourne, Australia) on 10 mm square dishes (Bio-strategy ...
-
bioRxiv - Cell Biology 2020Quote: ... or a FOXO1-targeted siRNA (GAGCGUGCCCUACUUCAAGGA) using the Amaxa(tm) Basic Nucleofector(tm) Kit for Primary Mammalian Fibroblasts (Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... The siRNA transfections for primary BMDMs and pancreatic fibroblasts were performed using the Mouse Macrophage Nucleofector™ Kit (Lonza) and Nucleofector™ 2b Device (Lonza ...
-
bioRxiv - Genetics 2019Quote: ... Primary VSMCs were cultured on gelatinized dishes in SmBM medium supplemented with the SmGM-2 kit (CC-3182, Lonza). Unless otherwise specified ...
-
bioRxiv - Molecular Biology 2021Quote: Human and mouse fibroblasts were cultured at 37°C and 5% CO2 in Dulbecco’s modified Eagle’s medium (Lonza) with high glucose supplemented with 10% foetal bovine serum ...
-
bioRxiv - Cell Biology 2022Quote: ... EGM-2 was then added to each well along with 200µl of normal human lung fibroblasts (CC2512, Lonza) at a concentration of 2×105 cells/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... peeled renal tubular epithelial cells were cultured in Primary medium (DMEM/F12, 10% FBS, 100U/mL penicillin, 100mg/mL streptomycin, amphotericinB, 1×REGM SingleQuots (CC-4127, Lonza)) in 6-well plates ...
-
bioRxiv - Molecular Biology 2019Quote: Wild type SV40-immortalized human fibroblasts (MRC5) were cultured in a 1:1 mixture of Ham’s F10 and DMEM (Lonza) supplemented with 1% antibiotics (penicillin and streptomycin ...
-
bioRxiv - Biochemistry 2021Quote: ... 100 μg ml−1 streptomycin and 15 ng ml−1 recombinant human macrophage colony stimulating factor (Lonza, Melbourne, Australia) on 10 mm square dishes (Bio-strategy ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.1% r-human fibroblast growth factor (rhFGF) and 0.1% Gentamicin sulfate amphotericin-B (GA-1000) (Lonza, Quakertown, PA, USA). HLFs were used from passages 1 to 10 ...
-
bioRxiv - Immunology 2023Quote: ... Cas9-gRNA ribonucleoproteins were assembled as described previously53 and nucleofected into 5×106 monocytes in 100μL nucleofection buffer (Human Monocyte Nucleofection Kit, Lonza) using a Nucleofector 2b (Lonza ...
-
bioRxiv - Developmental Biology 2024Quote: ... The constructs were stably introduced into the human iPSCs and mouse EpiSCs by electroporation with a 4D Nucleofector (Lonza) or using lipofectamine (Invitrogen).
-
bioRxiv - Developmental Biology 2024Quote: ... The constructs were stably introduced into the human iPSCs and mouse EpiSCs by electroporation with a 4D Nucleofector (Lonza) or using lipofectamine (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... by nucleofection using the Basic Nucleofector Kit for Primary Mammalian Fibroblasts with programme A-24 according to the manufacturer’s instructions (Lonza, Cologne, Germany). Cell clones were isolated after approximately 12 days of puromycin selection (1.5 µg/mL) ...
-
bioRxiv - Physiology 2019Quote: ... 10% AIM-V and 100 units/ml penicillin/ streptomycin and transiently transfected using Nucleofector™ Kits for Human Melanocytes (Lonza) or magnetofection with PolyMag Neo magnetic beads (OZ Biosciences) ...
-
bioRxiv - Genetics 2019Quote: ... Electroporation was performed using the Human Adult Dermal Fibroblast Nucleofector™ Kit and the Nucleofector™ II/2b device (Lonza). Both cell lines were harvested 72-hours post-transfection for qRT-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... and human ACTB (assay control, primer composition not disclosed by manufacturer) were loaded on a 2.5% agarose gel (Lonza, 50010) and stained with GelRed® (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... and diseased COPD human lung fibroblasts (DHLFs) from 3 donors (donor IDs: OF3353, OF3418 and OF3238) were purchased from Lonza and tested for their response to FGF2 and TGFβ stimulation.
-
bioRxiv - Cancer Biology 2022Quote: ... siControl and siIRAK4 were purchased from Horizon Discovery and transfected into human AML samples using Amaxa Nucleofector Kit T (Lonza) (program number G-016 ...
-
bioRxiv - Physiology 2022Quote: ... All human iPSC lines were negative for mycoplasma contamination as tested using the Mycoalert Mycoplasma testing kits (LT07-318, Lonza) and no karyotype abnormalities were found (KaryoStat+ ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
bioRxiv - Molecular Biology 2024Quote: ... All cell lines used are of human origin and were confirmed negative for mycoplasma before experimental use by using the MycoAlert Mycoplasma Detection Kit (Lonza) according to the the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines used are of human origin and were confirmed negative for mycoplasma before experimental use by using the MycoAlert Mycoplasma Detection Kit (Lonza) according to the manufacturer’s specifications.
-
bioRxiv - Cell Biology 2021Quote: Liver spheroids were prepared as previously described (Leite et al., 2016) except spheroids were formed from primary rat hepatocytes (Lonza, cat# RSCP01) and primary human HSCs ...
-
bioRxiv - Immunology 2022Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Supplementary Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... HSVECs were obtained by enzymatic collagenase digestion of human saphenous veins (Ethics 15/ES/0094) and maintained in EC growth medium (EGM-2 BulletKit™) (Lonza) supplemented with foetal bovine serum (10% ...
-
bioRxiv - Immunology 2024Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Extended Data Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: ... All human iPSC lines screened negative for mycoplasma contamination every other month using a MycoAlert PLUS detection kit (Lonza, LT07-710).
-
bioRxiv - Evolutionary Biology 2021Quote: DNA delivery into human/mouse ESCs for CRISPR/Cas9 targeting were performed using a Nucleofector 2b Device (Lonza, Cat. No. BioAAB-1001). Human Stem Cell Nucleofector Kit 1 (Cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4×106 cells were electroporated with 10 μg DNA of pBluescript II SK(+) carrying a human U6 promoter and EGFP-sgRNA using Nucleofector® V Kit (Lonza, Switzerland) as described above.