Labshake search
Citations for Lonza :
1451 - 1500 of 4595 citations for Rat Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... We periodically tested all the cell lines for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza, cat. no. LT07-118). Culturing conditions were as follows ...
-
bioRxiv - Immunology 2023Quote: ... Electroporation was performed with sgRNA/Cas9 RNP complexes using Alt-R Sp Cas9 Nuclease V3 (IDT) and using the 4D-Nucleofector with P3 Primary Cell 4D Nucleofector X Kit S (Lonza Bioscience).
-
bioRxiv - Neuroscience 2024Quote: ... digested for 3 min at 37 °C in Accutase and then resuspended in 60 μL nucleofection buffer from the Human Stem Cell Nucleofector™ Kit 2 (Lonza). The suspension was combined 2 μM Electroporation Enhancer (IDTDNA ...
-
bioRxiv - Bioengineering 2024Quote: ... The day of the electroporation cells were collected and washed twice with phosphate buffered saline (PBS) and resuspended in nucleofection buffer (SF/SE Cell Line 96-well Nucleofector™ Kit; Lonza) containing 2 μg of PEn mRNA and 100 pmol of synthetic springRNA or spaceRNA ...
-
bioRxiv - Immunology 2024Quote: ... Jurkat T cells were transfected with ON-TARGETplus SMARTpool human Piezo1 siRNA or control siRNA (Horizon Discovery, previously Dharmacon) with SE Cell Line 4D-Nucleofector™ X Kit (Lonza). Jurkat T cells were used for the experiment after 24 h.
-
bioRxiv - Cell Biology 2024Quote: ... and a control siRNA (D-001810-01-20 ON-TARGET plus Nontargeting siRNA #1) were prepared for electroporation using the Lonza SF Cell Line 4D-Nucleofector™ X Kit (V4XC-2012; Lonza) according to the manufacturer’s instruction with minor alterations ...
-
bioRxiv - Biophysics 2021Quote: ... for all imaging experiments involving exogenous expression we used the Lonza Amaxa II Nucleofector System with Cell Line Nucleofector Kit V reagent (Lonza VCA-1003). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: 1 million Jurkat cells were electroporated with the 2.5 μg of sgRNA plasmid and GFP control plasmid at a 10:1 ratio using an Amaxa Cell Line Nucleofector Kit V and an Amaxa™ Nucleofector™ II (Lonza). HeLa ...
-
bioRxiv - Cell Biology 2020Quote: ... Constructs were transfected into 3T3-F442A preadipocytes or OP9 preadipocytes via electroporation using the Amaxa Cell Line Nucleofector Kit V (Lonza, Cologne, Germany). Afterwards cells were grown two days in DMEM ...
-
bioRxiv - Developmental Biology 2021Quote: Human isogenic ESCs containing different lengths of CAG repeats in the HTT Exon1 locus (HD-RUES2 6) were nucleofected using the Cell Line Nucelofector II (Kit L from Lonza, Walkersville, MD) by applying the B-016 program ...
-
Optimization of AAV6 transduction enhances site-specific genome editing of primary human lymphocytesbioRxiv - Molecular Biology 2021Quote: ... Electroporation of K562 cells was performed using a SF Cell Line 4D-Nucleofector kit and 4D-X Nucleofector using pulse code FF-120 (Lonza, Basel, Switzerland), per the manufacturer’s recommendations ...
-
Redundant and specific roles of cohesin STAG subunits in chromatin looping and transcription controlbioRxiv - Cell Biology 2019Quote: The siRNA knockdown was performed by electroporation using the Amaxa nucleofector I in combination with the Amaxa Cell Line Nucleofector Kit V (Lonza, VCA-1003). SiRNA constructs with the siRNA cloned in the pLKO.1-Puro vector were obtained from the MISSION shRNA library (Sigma product SHGLY) ...
-
bioRxiv - Microbiology 2020Quote: ... using the AMAXA Nucleofector 4D system (U-033 setting) and the P3 primary cell 4D-nucleofector X kit with the 16-well nucleocuvette strip (Lonza, V4XP-3032). Clones were obtained by FACS using the FACS Aria II sorter at the Stanford Shared FACS Facility for the brightest red parasites and single cloning the TdTomato+ enriched population by limiting dilution into 96-well plates.
-
bioRxiv - Bioengineering 2019Quote: Nucleofection of the HDR template and CRISPR-Cas9 vectors was performed with SF Cell Line 4D-Nucleofection X Kit L (Lonza, V4XC-2024). Before nucleofection hybridoma cells were assessed for viability and centrifuged (90g ...
-
bioRxiv - Neuroscience 2019Quote: ... were provided under a MTA and maintained in Clonetics® endothelial cell growth medium-2 MV Bullet Kit (Cat# CC-3162 Lonza, UK) containing the endothelial basal medium ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza, Switzerland) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lines identities were validated by STR profiling and tested negative for mycoplasma with MycoAlert Mycoplasma Detection Kit (Lonza, Cat#LT07-418) prior to experimental use.
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... complex with a ratio of 4.5 to 1 between sgRNA and Cas9 was delivered following the protocol of the SE Cell Line 4D-NucleofectorTM X Kit (Lonza, V4XC-1012), using the nucleofection program DS-130 on the Lonza 4D X unit ...
-
bioRxiv - Systems Biology 2021Quote: ... freshly isolated neurons (5 million cells per nucleofection reaction) were transfected using the 4D-Nucleofector™ X Unit and the P3 Primary Cell 4D Nucleofector X kit (Lonza, Switzerland), as indicated ...
-
bioRxiv - Cancer Biology 2021Quote: ... AsPC-1 and CAPAN-1 pellets were suspended in Lonza transfection reagent (SE Cell Line 4D-Nucleofector™ X Kit L, Lonza, Germany) when the Mirus transfection reagent was finished ...
-
bioRxiv - Cell Biology 2021Quote: ... 500μg of gRNA and 500μg of donor plasmids were electroporated in 1×106 mESC using P3 Primary Cell 96-well Nucleofector™ Kit (Lonza, PBP3-22500) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2022Quote: ... 8 million cells were transfected with 20ug of plasmid DNA in one 100- uL cuvette using the Amaxa® Cell Line Nucleofector® Kit V (Lonza), program X-001 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Electroporation of 5×106 HL-60 cells was performed with AIO-GFP HAX1 LCRC1 and AIO-GFP HAX1 LCRC2 using CLB-Transfection™ Kit (Lonza, Austria) and CLB-Transfection™ System (Lonza ...
-
bioRxiv - Neuroscience 2022Quote: ... All cell lines were verified to be mycoplasma free by first culturing the cells in antibiotic-free media and then subjected to a mycoplasma tested using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, UK).
-
bioRxiv - Biophysics 2022Quote: ... 106 U2OS cells were transfected with 1 μg of px330 plasmid and 1 μg of the HDR donor plasmid using the Nucleofector 2b device and cell line nucleofector kit V (Lonza, VCA-1003) per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Point mutations were introduced into CJ7 WT using CRISPR RNP transfected into cells with the Amaxa mouse ES kit (Lonza VPH-1001). 1×106 cells were transfected with the RNP containing two separate guide RNAs a single stranded donor oligo and a linearized puromycin resistance gene ...
-
bioRxiv - Immunology 2020Quote: ... 106 cells per condition were nucleofected with 4 µg of DNA using the Amaxa Nucleofector II (Lonza, Kit R; program R-024). Nucleofected cells were allowed to recover for 24-48 hours before sorting for GFP positivity and lack of CD56 expression.
-
bioRxiv - Microbiology 2021Quote: ... All cell lines were routinely tested for the absence of mycoplasma using the MycoAlert Plus Mycoplasma Detection Kit from Lonza (Walkersville, MD).
-
bioRxiv - Neuroscience 2020Quote: ... 500 µl of cell media was collected and the presence of adenylate kinase was measured with the ToxiLightTM cytotoxicity assay kit (Lonza, Basel, Switzerland) to check the integrity of the cell membrane ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... All parasite strains and host cell lines were routinely tested for Mycoplasma contamination with the MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland) and found to be negative.
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transfected with pcDNA3.1 empty vector or pcDNA3.1 containing the human coding sequence of the VGLL2-NCOA2 fusion using the AMAXA cell line Nucleofection kit V (Lonza #VCA-1003;) and were selected in growth media containing 1μg/ml concentration of G418 (ThermoFisher #10131035) ...
-
bioRxiv - Biophysics 2021Quote: ... All cell lines were regularly tested for mycoplasma infection and were found to be negative (MycoAlert Plus Detection Kit, Lonza, LT07-710).
-
bioRxiv - Immunology 2020Quote: ... 2 million L1.2 cells were transfected with 2 µg of plasmid using the SG Cell Line transfection kit and a 4D-Nucleofector X (both from Lonza, Walkersville, MD) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 1 × 106 BLaER1 cells were transfected with 2 μg plasmid DNA using the Human B Cell Nucleofector Kit and Nucleofector I device (program U-15; both Lonza, Basel, Schweiz). On day 2 post transfection ...
-
bioRxiv - Microbiology 2021Quote: ... All cell lines were routinely tested to confirm absence of mycoplasma using the MycoAlert Plus Mycoplasma Detection Kit from Lonza (Walkersville, MD).
-
bioRxiv - Genomics 2021Quote: ... transfection of primary T cells with Cas9 RNP complexes and GSH1/GSH2-mRuby HDR templates was performed using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Single iPSCs were then nucleofected with the pX459v2 plasmid coding for the Cas9 protein and the sgRNA using P3 primary Cell 4D nucleofector kit (Lonza, V4XP-302). After nucleofection cells were plated on a 6-well plate in E8 flex medium supplemented with RevitaCell ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were co-transfected with 1 ug of firefly Luciferase vector and 0.1 ug Renilla luciferase vector by nucleofection with Lonza Cell Line Nucleofector® Kit V (Lonza, #VVCA-1003) and the T-020 program in the Amaxa Nucleofector II device ...
-
bioRxiv - Bioengineering 2022Quote: Cell cultures were monitored for the presence of mycoplasma contamination using the MycoAlert® Mycoplasma Detection Kit (Lonza #LT07-318, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The plasmids were co-transfected into H9 hESC cells using the Amaxa 4D nucleofector (#AAF-1003B and #AAF-1003X) and the P3 Primary Cell 4D-Nucleofector X kit (Lonza, #V4XP-3024).
-
bioRxiv - Molecular Biology 2022Quote: ... using nucleofection with the Amaxa 4D-Nucleofector X-Unit and the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, V4XP-3024 KT). 2×106 cells were harvested using accutase (Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells used in this study were negatively tested for mycoplasma contamination using MycoAlert™ Mycoplasma Detection Kit (LT07-118, Lonza, Switzerland).
-
bioRxiv - Cell Biology 2023Quote: ... 100,000 MCF10a cells was nucleofected with program DS-138 using an Amaxa 4D-Nucleofector X using the SE Cell Line 4D X Kit S 32 RCT (Lonza V4XC-1032). Reactions were split between two 24-well plates and grown in complete media three days ...
-
bioRxiv - Microbiology 2023Quote: ... with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Guides targeting CCNT1 were complexed with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were routinely confirmed to be negative for mycoplasma by testing with a MycoAlert Mycoplasma Detection Kit (Lonza # LT07-701).
-
bioRxiv - Bioengineering 2023Quote: ... were cultured in Endothelial Cell Basal Medium (EBM) supplemented with the Endothelial Growth Media kit (EGM-2) (CC-3162, Lonza, Basel, Switzerland). All cells were maintained at 37°C and 5% CO2 and used between passage number 3-7 ...
-
bioRxiv - Cancer Biology 2022Quote: ... All human cell lines were authenticated by STR analysis at the JCRB Cell Bank and tested for Mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).