Labshake search
Citations for Lonza :
1351 - 1400 of 4595 citations for Rat Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... hESCs were nucleofected with 2 μg of CRISPR and 3 μl ssODN (100 μm) using the P3 Primary Cell Kit L (Lonza). hESCs were then plated onto puromycin-resistant (DR4 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The guide RNA vector was then electroporated into the parent line containing the CRISPRi system using the Human Stem Cell Nucleofector Kit 1 solution with the Amaxa nucleofector 2b device (Lonza). Nucleofected cells were then seeded into a 6-well plate in mTeSR™-1 supplemented with Y-27632 (10 μM ...
-
bioRxiv - Systems Biology 2020Quote: ... Cell lines were confirmed to be mycoplasma-negative using the Mycoalert PLUS Mycoplasma detection kit (Lonza, Cat. No.: LT07-703).
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10,000,000 lymphoblastoid cells were nucleofected with 60 µg of RTW3027 and 20 µg of plasmid expressing gRNA and mCherry using Cell Line NucleofectorTM Kit V (Lonza) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... were nucleofected with 2 µg of each sgRNA/Cas9 plasmid and 3 pmol or 30 pmol (for E14-STNΔTsixP) repair oligo (Supplementary Table 6) using the Lonza 4D-Nucleofector with the P3 Primary Cell 4D-NucleofectorTM kit (Lonza) and CP-106 (for TXΔXertP and E14-STNΔTsixP ...
-
bioRxiv - Genetics 2020Quote: ... 2×105 UE control hPSCs were transfected with a pair of pSpCas9(BB)-2A-GFP constructs containing the specific sgRNAs (350 ng per construct) using P3 Primary Cell 4D-Nuclecfector X Kit (Lonza). The transfected cells were plated in Matrigel-coated dish and cultured for 2 days ...
-
bioRxiv - Immunology 2019Quote: ... HA-PLD1 or myc-PLD2 using Amaxa® Cell Line Nucleofector® Kit V reagent (cat. # VCA-1003, Lonza, Switzerland).
-
bioRxiv - Immunology 2019Quote: ... The U937 cells were electroporated using Lonza Nucleofector 2b (program W-001) and the Nucleofection Kit C (Lonza, VPA-1004). After electroporation ...
-
bioRxiv - Immunology 2019Quote: ... A20 and A20 D1.3 B cells (3 × 106cells) were transiently transfected using the AMAXA nucleofector kit V (Lonza, #VCA-1003) or the Ingenio electroporation kit (Mirus ...
-
bioRxiv - Genetics 2021Quote: ... were transfected with either KMT2D CRISPR-Cas9 vector or CRISPR-Cas9 empty vector together with GFP plasmid using P3 Primary Cell 4D-Nucleofector X kit (V4XP-3024, Lonza). Three days after transfection ...
-
bioRxiv - Genetics 2021Quote: ... first excised floxed Neomycin resistance cassette from Oct4 (CiA:Oct4) mESCs 12 by transfecting Cre-mCherry plasmid using Mouse Embryonic Stem Cell Nucleofector™ Kit from Lonza. After 24 hours after transfection ...
-
bioRxiv - Genetics 2021Quote: ... Cas9-sgRNA-Thy1.1 plasmid transfection was carried out by electroporation using Mouse Embryonic Stem Cell Nucleofector™ Kit from Lonza. After 36 hours of transfection Thy1.1 expressing cells were FACS sorted and sparsely seeded for clonal expansion on 15cm plate ...
-
bioRxiv - Cell Biology 2020Quote: ... All cell lines were authenticated by Multiplex Cell Line Authentication (MCA) and were tested for mycoplasma by MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Developmental Biology 2020Quote: ... Guide RNA vectors were nucleofected into the LaminB CRISPRi iPSC line using a P3 Primary Cell 96-well NucleofectorTM Kit (Lonza) and the 4D Nucleofector X Unit (Lonza ...
-
bioRxiv - Immunology 2021Quote: ... were transfected with 500 ng plasmid encoding pAcGFP-fused CDC42 variants or hMEFV-pAcGFP1-t2a-CDC42 using 4D-Nucleofector and the SG Cell Line 4D-Nucleofector X Kit (Lonza). Immediately after nucleofection ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were nucleofected with 1 nmol ASO against MERVL or Scramble ASO using P3 Primary Cell 96-well Nucleofector Kit (Lonza) according to manufacturer’s instruction and seeded into each well of a 24-well plate containing 500 µl of ESC medium with 2i ...
-
bioRxiv - Immunology 2022Quote: ... All cell lines were tested and confirmed mycoplasma-free using the protocol for Myco-Alert- Mycoplasma Detection Kit (LT07-218, Lonza).
-
bioRxiv - Cell Biology 2022Quote: ... Knock-in cell lines were generated according to procedures described previously1 and screened for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (Lonza). To activate auxin-inducible degradation ...
-
bioRxiv - Bioengineering 2022Quote: ... 90 μL of nucleofection solution (16.2 μL of Supplement solution mixed with 73.8 μL of SF solution from SF Cell Line 4D-Nucleofector™ X Kit L) (Lonza) was mixed thoroughly with the cell pellet ...
-
bioRxiv - Cell Biology 2022Quote: ... were plated in collagen-coated plastic and cultured in cell-specific basal media supplemented with a growth media kit (PromoCell; Lonza) and 5% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Neuroscience 2022Quote: ... The OPC cell cultures were regularly tested to be mycoplasma free using a MycoAlert Mycoplasma Detention Kit (Lonza, LT07-118). The OPCs were authenticated with immunopositivity for OPC cell markers (Nkx2—2 ...
-
bioRxiv - Neuroscience 2022Quote: ... neurons were transfected by electroporation before seeding with target siRNA or ntRNA using a 4D-Nucleofector X Unit and the corresponding P3 Primary Cell nucleofection kit (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... All cell lines were routinely tested for Mycoplasma contamination with the MycoAlert PLUS Mycoplasma Detection Kit (Lonza, Switzerland, LT07-705) and found to be negative.
-
bioRxiv - Immunology 2022Quote: ... Electroporation was performed using the Amaxa P3 Primary Cell 96-well Nucleofector kit and 4D-Nucleofecter (Lonza, Walkersville, MD, USA). crRNAs were selected from CRISPR sgRNA database of (Genscript ...
-
bioRxiv - Cancer Biology 2022Quote: ... Generation of the MDA-MB-231 HAS overexpressing cells was conducted using either the pPB huHAS2-IRES2-mScarlet-IRES2-NeoR or pPB huHAS3-IRES2-mScarlet-IRES2-NeoR or with the Piggybac transponase using the Nucleofector Cell Line Kit V (Lonza). Stably transfected cells were selected using 1 μg/mL puromycin (MilliporeSigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in 90 µL of nucleofection solution (16.2 µL of Supplement solution mixed with 73.8 µL of SF solution from SF Cell Line 4D-Nucleofector™ X Kit L) (Lonza), transferred to the 15 µL RNP solution ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... 01F49i-N-B7 iPSCs were dissociated to single cells and 250,000 cells transfected with 25 μL of the prepared transfection mix containing 20 µL of nucleofection buffer (P3 Primary Cell 4D-NucleofectorTM X Kit S, Lonza), 5 µL of the RNP complex ...
-
bioRxiv - Immunology 2023Quote: CRISPR–Cas9 gene knockout was performed by transient Cas9/gRNA (RNP) complex electroporation using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). On day 4 of culture ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were routinely tested for mycoplasma contamination using a MycoAlert PLUS Mycoplasma Detection Kit (#LT07-710, Lonza, Switzerland).
-
Efficient Methods for Target Gene Manipulation in Haematopoietic Stem Cell Derived Human NeutrophilsbioRxiv - Cell Biology 2023Quote: ... CD34+ HSPC selected as previously described were preconditioned in SFEM II and StemSpan cytokines for 72 hours and electroporated with the Cas9-gRNP mixture using the Human CD34+ Cell Nucleofector kit (Lonza) in a Lonza IIb Nucleofector using program U-008 ...
-
bioRxiv - Neuroscience 2023Quote: ... before being introduced to the KOLF2 hiPSCs through electroporation (P3 Primary Cell 4D-Nucleofector X Kit, Program CA-137, Lonza). The resulting clones were screened by multiplexed amplicon sequencing on an Illumina Mi-Seq platform with the MiSeq Reagent Kit V2 (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell lines were authenticated and regularly tested for Mycoplasma using the MycoAlert PLUS detection kit by Lonza (LT07-710).
-
bioRxiv - Bioengineering 2023Quote: Approximately 0.25 × 106 U2OS.eGFP-PEST cells were nucleofected with 300 ng of Cas9 expression plasmid and 30 ng of eGFP-targeting gRNA expression plasmid using the SE Cell line 4D-Nucleofector X Kit (Lonza) and DN100 pulse program ...
-
bioRxiv - Bioengineering 2023Quote: ... and 50 ng of AcrIIA4 expression or 300 ng of Cas9-P2A-CSD-AcrIIIA4 plasmid and 30 ng eGFP-targeting gRNA expression plasmid using the SE Cell line 4D-Nucleofector X Kit (Lonza) and DN100 pulse program ...
-
bioRxiv - Cell Biology 2023Quote: ... were delivered as a ribonucleoprotein complex with the DNA donor template using a Nucleofector 2b Device and the Human Stem Cell Nucleofector Kit 1 (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were authenticated by Multiplex Cell Line Authentication (MCA) and were tested for mycoplasma by MycoAlert Mycoplasma Detection Kit (Lonza). U2OS cells were transfected with the plasmids using Lipofectamine 2000 and according to the manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were nucleofected with 4 µg of the sgRNA-containing plasmid individually following the Amaxa Mouse ES cell Nucleofector kit recommendations (VPH-1001, Lonza). Later ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell lines used in this study were routinely tested for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (#LT07-318, Lonza), and mycoplasma-negative cells were used ...
-
bioRxiv - Cell Biology 2023Quote: ... hESCs were nucleofected with RNPs using the 4D-Nucleofector and P3 Primary Cell 4D-Nucleofector X Kit and program CB150 (Lonza). After 24□hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines have been regularly monitored and tested negative for mycoplasma using a mycoplasma detection kit (Lonza, LT07-218).
-
bioRxiv - Systems Biology 2024Quote: The reporter cell line for the PTGR screen was created by nucleofection of haploid AN3-12 mESCs with 500ng of the reporter construct and 10 µg of a Tol2 transposase encoding plasmid using the Mouse ES Cell Nucleofector Kit (Lonza) according to the manufacturer’s protocol using an Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Biochemistry 2023Quote: ... 100pmol synthetic pegRNA (IDT) and 50pmol sgRNA (IDT) using the P3 primary cell nucleofector kit (cat#V4XP-3032, Lonza Biosciences) and program EH-115 on an Amaxa 4D-Nucleofector ...
-
bioRxiv - Cell Biology 2023Quote: ... nucleofected in a 100 µl reaction using the Lonza 4D-Nucleofector System with P3 Primary Cell 4D-Nucleofector X Kit (Lonza) and program CA137 ...
-
bioRxiv - Immunology 2023Quote: ... The transfection was carried out by nucleofection using Amaxa® Cell Line Nucleofector Kit V (Program X-001, Lonza, USA). At 24 h after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... we routinely checked cell cultures for the presence of mycoplasma using the MycoAlert™ Mycoplasma Detection Kit (#LT07-218, Lonza).
-
bioRxiv - Synthetic Biology 2023Quote: ... The absence of mycoplasma contamination in cell cultures was frequently validated using the MycoAlert Mycoplasma Detection Kit (Lonza, NY, USA).
-
bioRxiv - Neuroscience 2024Quote: ... The RNP complex was subsequently transfected into dissociated iPSCs by electroporation with Lonza Nucleofector 2B using the Amaxa Human Stem Cell Nucleofector Starter Kit (Lonza) according to manufacturer’s manual ...