Labshake search
Citations for Lonza :
1451 - 1500 of 1807 citations for Mouse IL 13 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... and cells were resuspended according to the protocol provided for the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: Cas9-RNPs were transfected into cells by electroporation (SF Cell Line 4D-Nucleofector™ X Kit S (Lonza, #V4XC-2032)) ...
-
Efficient Methods for Target Gene Manipulation in Haematopoietic Stem Cell Derived Human NeutrophilsbioRxiv - Cell Biology 2023Quote: ... CD34+ HSPC selected as previously described were preconditioned in SFEM II and StemSpan cytokines for 72 hours and electroporated with the Cas9-gRNP mixture using the Human CD34+ Cell Nucleofector kit (Lonza) in a Lonza IIb Nucleofector using program U-008 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell lines were authenticated and regularly tested for Mycoplasma using the MycoAlert PLUS detection kit by Lonza (LT07-710).
-
bioRxiv - Bioengineering 2023Quote: Approximately 0.25 × 106 U2OS.eGFP-PEST cells were nucleofected with 300 ng of Cas9 expression plasmid and 30 ng of eGFP-targeting gRNA expression plasmid using the SE Cell line 4D-Nucleofector X Kit (Lonza) and DN100 pulse program ...
-
bioRxiv - Bioengineering 2023Quote: ... and 50 ng of AcrIIA4 expression or 300 ng of Cas9-P2A-CSD-AcrIIIA4 plasmid and 30 ng eGFP-targeting gRNA expression plasmid using the SE Cell line 4D-Nucleofector X Kit (Lonza) and DN100 pulse program ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines used are of human origin and were confirmed negative for mycoplasma before experimental use by using the MycoAlert Mycoplasma Detection Kit (Lonza) according to the manufacturer’s specifications.
-
bioRxiv - Cell Biology 2023Quote: Differentiated HL-60 cells were nucleofected with Amaxa Nucleofector II device and Amaxa Cell line kit V (Lonza, VACA-1003) and prepared for live-cell imaging using aslightly modified version of an existing protocol 96 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Two gRNA plasmids and pCas9 (D10)-GFP plasmid were nucleofected into cells using Basic Nucleofector Kit for Primary Mammalian Epithelial Cells (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... were delivered as a ribonucleoprotein complex with the DNA donor template using a Nucleofector 2b Device and the Human Stem Cell Nucleofector Kit 1 (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were authenticated by Multiplex Cell Line Authentication (MCA) and were tested for mycoplasma by MycoAlert Mycoplasma Detection Kit (Lonza). U2OS cells were transfected with the plasmids using Lipofectamine 2000 and according to the manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: LCLs were treated with 2nM Retinoic acid for 24 hours prior to transfection of firefly and renilla luciferase constructs by Amaxa Nucleofector kit V (Lonza) with the X001 program on a Nucleofector II device ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell lines used in this study were routinely tested for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (#LT07-318, Lonza), and mycoplasma-negative cells were used ...
-
bioRxiv - Cell Biology 2023Quote: ... hESCs were nucleofected with RNPs using the 4D-Nucleofector and P3 Primary Cell 4D-Nucleofector X Kit and program CB150 (Lonza). After 24□hours ...
-
bioRxiv - Cell Biology 2023Quote: ... Five million BJAB or OCI-LY1 cells were transfected with 2 μg plasmid DNA using the SF Cell Line 4D-Nucleofector X Kit L (Lonza) and the AMAXA Nucleofector biosystem (BJAB ...
-
bioRxiv - Developmental Biology 2023Quote: ... and co-transfected with an ssODN donor template containing the desired modification into H9/WA09 cells via nucleofection (Amaxa P3 primary cell 4D nucleofector X kit L, Lonza) using the manufacturer’s recommended protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... we routinely checked cell cultures for the presence of mycoplasma using the MycoAlert™ Mycoplasma Detection Kit (#LT07-218, Lonza).
-
bioRxiv - Genomics 2023Quote: ... 2.5e5 RPE1 CRISPRi cells were nucleofected with 3μM RNP complex using an SE Cell Line 4D X Kit S (Lonza Bioscience) on a 4D-Nucleofector (Lonza Bioscience ...
-
bioRxiv - Neuroscience 2023Quote: ... before being introduced to the KOLF2 hiPSCs through electroporation (P3 Primary Cell 4D-Nucleofector X Kit, Program CA-137, Lonza). The resulting clones were screened by multiplexed amplicon sequencing on an Illumina Mi-Seq platform with the MiSeq Reagent Kit V2 (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: ... the presence of mycoplasma in the cultures was regularly screened using the MycoAlert™ Mycoplasma Detection Kit (#LT07-218, Lonza).
-
bioRxiv - Bioengineering 2023Quote: ... Both cell lines were maintained in an incubator at 37 °C and 5% CO2 and tested for Mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza) regularly.
-
bioRxiv - Biochemistry 2023Quote: ... at 5% CO2 at 37 °C in accordance with standard mammalian tissue culture protocols and periodically tested for mycoplasma contamination via the MycoAlert Mycoplasma Detection kit (Lonza).
-
bioRxiv - Biophysics 2023Quote: ... MCF7 and A375 cells (ATCC) were transfected with 1 μg DNA using the SF Cell Line 4D-Nucleofector kit (Lonza) following the manufacturer’s instructions via electroporation (4D-Nucleofector ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were maintained at 37°C in 5% CO2 and frequently examined for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Synthetic Biology 2023Quote: ... The absence of mycoplasma contamination in cell cultures was frequently validated using the MycoAlert Mycoplasma Detection Kit (Lonza, NY, USA).
-
bioRxiv - Neuroscience 2023Quote: ... The cell pellet was used for nucleofection using the P3 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-3024), a 4D-nucleofector core unit and X unit (Lonza ...
-
bioRxiv - Genomics 2023Quote: ... were purchased from ATCC and cultured in endothelial cell growth basal medium-2 containing bullet kit growth factor supplements (EBM-2 [endothelial cell growth basal medium-2]; Lonza), 5% fetal bovine serum ...
-
bioRxiv - Genomics 2023Quote: ... All cell lines were authenticated by short tandem repeat (STR) profiling and verified mycoplasma free using the MycoAlert PLUS Mycoplasma Detection kit (Lonza) prior to conducting experiments ...
-
bioRxiv - Biochemistry 2023Quote: ... 100pmol synthetic pegRNA (IDT) and 50pmol sgRNA (IDT) using the P3 primary cell nucleofector kit (cat#V4XP-3032, Lonza Biosciences) and program EH-115 on an Amaxa 4D-Nucleofector ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were treated with mycoplasma removal agent (MP Biomedical) and tested monthly for mycoplasma contamination using MycoAlert Plus mycoplasma testing kit (Lonza). SeV Cantell strain was grown in 10-day-old ...
-
bioRxiv - Molecular Biology 2023Quote: ... spanning the whole SARS-CoV-2 genome was transfected into 2×106 HEK293T cells using the SF Cell Line 4D-Nucleofector-X Kit (Cat# V4XC-2012, Lonza) and the 4D-Nucleofector X Unit (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... T cells were washed with PBS and resuspended at 100x106 cells/mL in Lonza P3 Primary Cell 4D Nucleofector Kit buffer (Lonza). 1μg/1x106 cells of sgRNA (Agilent ...
-
bioRxiv - Molecular Biology 2024Quote: All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza). Human primary hepatic stellate cells used for the main experiments were from Lonza (HUCLS ...
-
bioRxiv - Immunology 2024Quote: 3×106 of 3-day activated CD8+ T cells were transfected using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 with 1.5/106 ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines have been regularly monitored and tested negative for mycoplasma using a mycoplasma detection kit (Lonza, LT07-218).
-
bioRxiv - Cell Biology 2024Quote: ... nucleofected in a 100 µl reaction using the Lonza 4D-Nucleofector System with P3 Primary Cell 4D-Nucleofector X Kit (Lonza) and program CA137 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The constructs were then transfected into WT OSCs and Δl(3)mbt-OSCs with Nucleofector Kit V (Lonza, VVCA-1003) using T-029 program and a NucleofectorTM 2b Device (Lonza) ...
-
bioRxiv - Biophysics 2024Quote: ... 0.5 μg of F-tractin-mScarlet plasmid and 0.75 ug of Zyxin-mNeonGreen plasmid were mixed with solution SE from SE Cell Line 4D-Nucleofector S Kits (Lonza). 4×105 cells were mixed with the plasmid-SE solution and nucleofected with program CM-137 using a 4D-Nucleofector (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... All cell lines were authenticated by Multiplex Cell Line Authentication (MCA) and were tested for mycoplasma by MycoAlert Mycoplasma Detection Kit (Lonza). HEK293T cells were transfected with the plasmids using 1mg/ml polyethylenimine ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were routinely screened throughout the study and found to be negative for mycoplasma with the MycoAlert detection kit (Lonza).
-
bioRxiv - Cancer Biology 2024Quote: ... All primary cells were used at passages below 10 and were regularly tested for mycoplasma using the MycoAlert Mycoplasma Detection kit (Lonza). For the onset of transgenic expression cells were treated with 200 ng/mL DOX for 48 hours before being subjected to downstream assays unless otherwise specified.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg of pHTN HaloTag-CENP-A plasmid was used for transfection performed on Nucleofector Kit R with the Nucleofector 2b Device (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 and tested negative for mycoplasma contamination by MycoAlert mycoplasma detection kit (Lonza). Expression of doxycycline-inducible shRNA was induced by supplementing media with 0.1-1 µg/ml doxycycline for 6 days ...
-
Antibodies targeting Crimean-Congo hemorrhagic fever virus GP38 limit vascular leak and viral spreadbioRxiv - Microbiology 2024Quote: ... All endothelial cells were cultured in endothelial cell growth basal medium 2 supplemented with an Endothelial Cell Growth Medium-2 (EGM-2) microvascular cells supplemental bullet kit (Lonza) and maintained at 37 °C with 5% CO2.
-
bioRxiv - Immunology 2024Quote: ... and the GFPSpark and mCherry control vectors (DNA/cell ratio = 1.5 µg/106 cells in single transfections and 1.2 µg/106 cells in co-transfections) by using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 ...
-
bioRxiv - Immunology 2024Quote: For RNAi-mediated TSP-1 and TSP-4 silencing 4×106 3-day activated CD8+ T cells were transfected using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 with 150 pmol/106 cells of human TSP-1 and TSP-4-specific siRNAs (#s14108 and #s14100 ...
-
bioRxiv - Immunology 2024Quote: ... 8×106 CTLs were transfected with 6 µg of plasmid DNA of each construct with P3 Primary Cell 4D-Nucleofector X Kit (Lonza). For the CLEM experiments the cells were transfected with TSP-1-GFPSpark and TSP-4-mCherry ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Neuroscience 2024Quote: ... All fibroblasts and iPSCs were screened for mycoplasma monthly via MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza Cat # 75860-362). iPSCs were grown in medium-sized colonies on Matrigel (BD Biosciences cat# ...