Labshake search
Citations for Lonza :
1401 - 1450 of 1807 citations for Mouse IL 13 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Electroporation was performed using the Amaxa P3 Primary Cell 96-well Nucleofector kit and 4D-Nucleofecter (Lonza, Walkersville, MD, USA). crRNAs were selected from CRISPR sgRNA database of (Genscript ...
-
bioRxiv - Microbiology 2022Quote: ... All cell lines used in this study were routinely tested for mycoplasma and found to be mycoplasma-free (MycoAlert Mycoplasma Detection Kit MycoAlert, Lonza). Flp-In™ T-REx™ 293 cells were cultured according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines have been periodically subjected to re-confirmation by Short Tandem Repeat (STR) profiling by ATCC and mycoplasma testing by MycoAlertTM PLUS mycoplasma detection Kit (Lonza). YUHEF ...
-
bioRxiv - Cancer Biology 2022Quote: ... Generation of the MDA-MB-231 HAS overexpressing cells was conducted using either the pPB huHAS2-IRES2-mScarlet-IRES2-NeoR or pPB huHAS3-IRES2-mScarlet-IRES2-NeoR or with the Piggybac transponase using the Nucleofector Cell Line Kit V (Lonza). Stably transfected cells were selected using 1 μg/mL puromycin (MilliporeSigma ...
-
bioRxiv - Neuroscience 2022Quote: Neurons were nucleofected with identified plasmids prior to plating at 0 DIV using Amaxa Rat Neuron Nucleofector kit (DGP-1003; Lonza) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cells were maintained at 37°C and 5% CO2 and 95% relative humidity and regularly tested negative for mycoplasma infection by Mycoalert detection kit (Lonza). For 3D growth conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... Two million of MNCs were transfected with 10 μg of plasmid (5:1 ratio pEB-C5:pEBTg) as instructed by the Lonza CD34+ nucleofector kit (VPA-1003, Lonza) and Amaxa nucleofector (program T-016 ...
-
bioRxiv - Bioengineering 2024Quote: ... HSPCs (2×105 cells/condition) were transfected with RNP complexes using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza) and the CA137 program (Nucleofector 4D ...
-
bioRxiv - Cell Biology 2024Quote: ... Those cells were cultured in DPSC growth medium (DPSC-GM) by adding the contents of a DPSC SingleQuots Kit (PT-4516; Lonza) to DPSC Basal Medium (DPSC-BM ...
-
bioRxiv - Biophysics 2023Quote: ... Any CD146 positive cells were eluted from the column using 5 mL warmed EGM-2 growth medium supplemented with EGM-2 bullet kit (Lonza). The cells were pelleted with a 300 g spin for 5 min and counted in 1 mL EGM-2 media ...
-
bioRxiv - Cell Biology 2024Quote: ... together with a plasmid encoding the piggyBac transposase in a 3:1 ratio (vector:transposase) using the P3 Primary cell 4D-Nucleofector™ kit (Lonza). Prior to targeting ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were nucleofected with plasmids of interest using the Lonza 2b Nucleofector and Rat cardiomyocyte Nucleofector Kit (Lonza, VAPE-1002) according to the manufacturer’s instruction.
-
bioRxiv - Neuroscience 2023Quote: ... Neurons were nucleofected with plasmids of interest using the Lonza 2b Nucleofector and Rat Neuron Nucleofector Kit (Lonza, VPG-1003) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell and siRNA mixture resuspended in 100 µl of Nucleofector Solution for Human Keratinocytes provided with Human Keratinocyte Nucleofector kit (VPD-1002, Lonza). Nucleofection performed on program X-001 of Amaxa Biosystems Nucleofector II electroporator transfection unit ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 × 106 OSCs were transfected with 4 μg of pPB-TRE3G-FLAG-Rhino-Tjen-trTA-P2A-BlastR and 1 μg of pHsp70-Myc-hyPBase using Nucleofector Kit V (Lonza). After incubation in media containing blasticidin (50 μg/mL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... All cell lines used are of human origin and were confirmed negative for mycoplasma before experimental use by using the MycoAlert Mycoplasma Detection Kit (Lonza) according to the the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The RNP complex was subsequently transfected into dissociated iPSCs by electroporation with Lonza Nucleofector 2B using the Amaxa Human Stem Cell Nucleofector Starter Kit (Lonza) according to manufacturer’s manual ...
-
bioRxiv - Immunology 2024Quote: The absence of Mycoplasma in the cell lines was routinely controlled using the MycoAlert mycoplasma detection kit (Lonza, LT07-318).
-
bioRxiv - Genomics 2024Quote: Transfections of DNA constructs in ESCs were performed using the P3 Primary Cell 4D-Nucleofector X Kit (V4XP-3024) and the Amaxa 4D Nucleofector system (Lonza). For each nucleofection ...
-
bioRxiv - Microbiology 2024Quote: Raw264.7 CRISPR cells were generated by electroporation of low passage Raw264.7 cells with Dhx58 and Ifih1 pSBtet-puro-Cas9-U6 using Amaxa Nucleofector II and Amaxa Cell Line Nucleofector Kit V (Lonza). Cells were selected with puromycin 3 days post-nucleofection ...
-
bioRxiv - Cell Biology 2023Quote: ... and Cas9-GFP were then transfected into human iPSCs for INS mutation correction using embryonic stem cell Nucleofector Kit (VVPH-5012, Lonza). Transfected cells were cultivated in StemFlex medium (catalog #A3349401 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The absence of mycoplasma contamination in cell cultures was frequently validated using the MycoAlert Mycoplasma Detection Kit (Lonza, NY, USA).
-
bioRxiv - Genomics 2023Quote: ... were purchased from ATCC and cultured in endothelial cell growth basal medium-2 containing bullet kit growth factor supplements (EBM-2 [endothelial cell growth basal medium-2]; Lonza), 5% fetal bovine serum ...
-
bioRxiv - Immunology 2024Quote: ... Plasmids were sequenced at the OHSU sequencing core and transfected into BEAS-2B MR1-/- cells using the Amaxa nucleofection system with Kit T solution (Lonza). The transfection efficiency was evaluated via GFP expression by flow cytometry (Supplementary Figure 4) ...
-
bioRxiv - Immunology 2024Quote: ... were nucleofected into 1e6 BEAS-2B WT cells at 300 nM according to the manufacturer’s instructions (Lonza, Nucleofector Kit T). Cells were allowed to rest overnight (TAPBPR and tapasin ...
-
bioRxiv - Cancer Biology 2023Quote: ... twice and resuspended in Cell Line Nucleofector solution SF (16.4uL) with Supplement (3.6uL) (SF Cell Line 4D-nucleofector X Kit, Lonza, V4XC-2032). Alt-R SpCas9 nuclease (100pmol ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in 90 µL of nucleofection solution (16.2 µL of Supplement solution mixed with 73.8 µL of SF solution from SF Cell Line 4D-Nucleofector™ X Kit L) (Lonza), transferred to the 15 µL RNP solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were resuspended in respective electroporation/nucleofection buffer (HEK293T cells and HepG2 SF Buffer (SF Cell Line 4D-Nucleofector X Kit, Lonza), Jurkat cells SE buffer (SE Cell Line 4D-Nucleofector X Kit ...
-
bioRxiv - Microbiology 2023Quote: Constructed plasmids encoding AS1-S were introduced into MDBK cells using Amaxa cell line Nucleofector kit R (Lonza, Kanagawa, Japan) with Amaxa Nucleofector II system in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... isolated WT P14 CD8+ T cells were washed with PBS and mixed with RNPs by using P3 Primary Cell 4D-NucleofectorTM X Kit (Lonza) immediately prior to electroporation (Lonza 4D-nucleofactorTM core unit ...
-
bioRxiv - Neuroscience 2023Quote: ... 01F49i-N-B7 iPSCs were dissociated to single cells and 250,000 cells transfected with 25 μL of the prepared transfection mix containing 20 µL of nucleofection buffer (P3 Primary Cell 4D-NucleofectorTM X Kit S, Lonza), 5 µL of the RNP complex ...
-
bioRxiv - Immunology 2023Quote: CRISPR–Cas9 gene knockout was performed by transient Cas9/gRNA (RNP) complex electroporation using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). On day 4 of culture ...
-
bioRxiv - Genomics 2023Quote: ... 2.5e5 RPE1 CRISPRi cells were nucleofected with 3μM RNP complex using an SE Cell Line 4D X Kit S (Lonza Bioscience) on a 4D-Nucleofector (Lonza Bioscience ...
-
bioRxiv - Genomics 2023Quote: ... Neurons were nucleofected with 10 µ total DNA plasmid DNA using the AD1 4D-Nucleofector Y kit (Lonza V4YP-1A24) with the ED158 (iCell GlutaNeurons ...
-
bioRxiv - Cell Biology 2023Quote: ... T cells were washed with PBS and resuspended at 100x106 cells/mL in Lonza P3 Primary Cell 4D Nucleofector Kit buffer (Lonza). 1μg/1x106 cells of sgRNA (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were co-transfected with 2 µg of the CRISPR/Cas9 plasmid and 2 µg of ssODN (50 µM) using a Nucleofector II and Amaxa Nucleofector kits (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... and cells were resuspended according to the protocol provided for the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were routinely tested for mycoplasma contamination using a MycoAlert PLUS Mycoplasma Detection Kit (#LT07-710, Lonza, Switzerland).
-
bioRxiv - Cancer Biology 2023Quote: ... The dissociated GSCs (1 × 106 cells) were resuspended in 100 μl of supplemented solution of the Human Stem Cell Nucleofector Kit 1 (Lonza) containing a combination of the px458 plasmid targeting each gene and the ssODN and then electroporated using B-016 program of Nucleofector 2b (Lonza) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-6 million primary human keratinocytes were electroporated with 1 nmol siPools using the Amaxa human keratinocyte Nucleofector kit (Lonza) according to the manufacturer’s instructions and the T-018 program of the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Microbiology 2023Quote: ... The genotypic identity of the parasites (28) and the absence of Mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza) were verified regularly ...
-
bioRxiv - Cancer Biology 2023Quote: Cas9-RNPs were transfected into cells by electroporation (SF Cell Line 4D-Nucleofector™ X Kit S (Lonza, #V4XC-2032)) ...
-
bioRxiv - Microbiology 2023Quote: ... Ribonucleoproteins were introduced into 1 x 106 sub-confluent BLaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Molecular Biology 2023Quote: Transfections of K562 cells were performed using a Lonza Bioscience 4D-Nucleofector system and the SF Cell Line 4D-Nucleofector X kits (Lonza). For single nucleocuvettes (100 uL) ...
-
bioRxiv - Microbiology 2023Quote: ... amazonensis promastigotes using the Human T-Cell Nucleofector kit and the Amaxa Nucleofector electroporator (program U-033, Lonza, Basel, Switzerland), for integration into the 18S rRNA locus within the nuclear DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2000 p mol of a degron-tagged control protein (mTagBFP2-RxxG) in a 100 µl nucleofection reaction (4D nucleofector kit SE plus supplement SF1, Lonza) 14 hours following nucleofection ...
-
Efficient Methods for Target Gene Manipulation in Haematopoietic Stem Cell Derived Human NeutrophilsbioRxiv - Cell Biology 2023Quote: ... CD34+ HSPC selected as previously described were preconditioned in SFEM II and StemSpan cytokines for 72 hours and electroporated with the Cas9-gRNP mixture using the Human CD34+ Cell Nucleofector kit (Lonza) in a Lonza IIb Nucleofector using program U-008 ...
-
bioRxiv - Neuroscience 2023Quote: ... before being introduced to the KOLF2 hiPSCs through electroporation (P3 Primary Cell 4D-Nucleofector X Kit, Program CA-137, Lonza). The resulting clones were screened by multiplexed amplicon sequencing on an Illumina Mi-Seq platform with the MiSeq Reagent Kit V2 (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell lines were authenticated and regularly tested for Mycoplasma using the MycoAlert PLUS detection kit by Lonza (LT07-710).