Labshake search
Citations for Lonza :
101 - 150 of 167 citations for Hexadecanoic acid reaction products with tetraethylenepentamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: Amino acid starvation treatment was carried out by incubating cells in HBSS buffer (Lonza) with 10% dialyzed FBS (Sigma Aldrich) ...
-
bioRxiv - Bioengineering 2021Quote: ... cells were nucleofected in 20μl reaction of SF Cell Line Nucleofector Solution (Lonza V4XC-2032) using the Lonza Nucleofector 4D (program CM-130) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 250,000 single cells were used for a small reaction of electroporation (Lonza V4XP-3032) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... 50’000 preMacs per reaction were resuspended in 20 µl P3 Primary Cell Nucleofector Solution (Lonza) and mixed with CRISPR/Cas9 RNPs before nucleofection with CM-137 pulse code in a 96-well nucleofection plate using a 4D-Nucleofector 96-well Shuttle nucleofector (Lonza) ...
-
bioRxiv - Biochemistry 2024Quote: ... The mixture of non-essential amino acids (NEAA, 100X) was purchased from Lonza (Basel, Switzerland). For mammalian cell culture ...
-
bioRxiv - Plant Biology 2023Quote: ... and PCR products were separated by agarose gel electrophoresis in an 1% w/v agarose gel (Lonza, 50004) using 100V during 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR product presence was confirmed with gel electrophoresis using the FlashGel® System (Lonza, Rockland, ME, USA). PCR products were then purified with the HighPrep® PCR kit (MagBio Genomics ...
-
bioRxiv - Neuroscience 2022Quote: ... Electrophoresis of 10 µl of RT-PCR products was performed using 3% agarose (SeaKem LE Agarose by Lonza) with molecular ladder gel containing 0.5 µg/ml ethidium bromide in x0.5 tris-acetate-ethylenediaminetetraacetic acid (TAE ...
-
bioRxiv - Genomics 2023Quote: ... Nucleofection reaction was conducted by the program of EM110 in a 4D-Nucleofector X Unit (Lonza). After the run completion ...
-
bioRxiv - Immunology 2024Quote: ... an electroporation reaction consisted of 2 × 105 HEK293T cells in 20 μL of SF buffer (Lonza) and 2 μL of 20 μM Cas9 RNP (equivalent to 40 pmol final concentration) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The nucleofection reactions are added to a 96-well nucleofection plate (Lonza Cat. No. V4SC-2960) and pulsed with a CM156 pulse in the Lonza 4D-Nucleofector (Cat ...
-
bioRxiv - Microbiology 2020Quote: ... Gibco) with addition of non-essential amino acids (100X NEAA, Biowhittaker Lonza, cat. no. BE13-114E). H2L2 antibodies were purified from hybridoma culture supernatants using Protein-G affinity chromatography ...
-
bioRxiv - Genetics 2020Quote: ... and cells were resuspended in 20µL/reaction of room-temperature Lonza nucleofection buffer P2 (Lonza V4XP-2024). The cell suspension was gently mixed with 2.5µL/reaction of appropriate RNP and then pipetted into a 96-well-format nucleofection cuvette for the Lonza 4D X unit or Shuttle unit (Lonza) ...
-
bioRxiv - Microbiology 2021Quote: Each transfection reaction was prepared by adding 2 µl of “primed” cells resuspended in SG buffer (Lonza) to a mixture of ...
-
bioRxiv - Neuroscience 2024Quote: ... and the nucleofection reaction was prepared using the Cell Line Nucleofector™ Kit V (Lonza; VCA-1003) as per manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: For nucleofection of fibroblasts (2x10^6 cells per reaction) the P2 Primary Cell 4D-Nucleofector Kit (Lonza) was used ...
-
bioRxiv - Cancer Biology 2024Quote: ... were separated on a PA-TBE gel and stained with GelStarTM Nucleic Acid Gel Stain (Lonza, 50535).
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were washed with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffered saline solution (CC-5024, Lonza) before renewing the medium or passaging the cells ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The product was purified and 2 µg were added to the RNP and diluted in 100 µL P3 nucleofection buffer (Lonza). This mixture was nucleofected with 2×106 stimulated human primary T cells using the 4D-Nucleofector (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... Each transfection reaction was transferred to one well in 16-well nucleofection strip (Lonza; Cat. No. V4XC-2032). The nucleofection strip was placed in the X-unit (Lonza ...
-
bioRxiv - Immunology 2024Quote: ... 16.4µl P3 and 3.6µl Supplement Reaction solutions from P3 Primary Cell 4D X Kit S (Lonza V4XP-3032) were added ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... This reaction mix was loaded into a 96-well nucleofection plate (Lonza Cat. No. AAF-1003S, AAF-1003B), and pulsed with CU 154 (Fig ...
-
bioRxiv - Genetics 2024Quote: PHA-L-stimulated PBMCs (2.0-2.5x10^7 cells per reaction) were nucleofected with the P3 Primary Cell 4D-Nucleofector Kit (Lonza). After application of program EO-115 ...
-
bioRxiv - Microbiology 2022Quote: ... and stained with 10 × SYBR Green I (SYBR® Green I Nucleic Acid Stain; Lonza, Rockland, ME, USA) in 1×TAE buffer for 3 min ...
-
bioRxiv - Bioengineering 2023Quote: The DBM powders were decellularized in a solution of 0.05% trypsin with 0.02% ethylenediaminetetraacetic acid (trypsin/EDTA, Lonza) at 37 °C and 5% CO2 incubator under agitation for 24 hours (Figure 1c) ...
-
bioRxiv - Cancer Biology 2021Quote: Primary human lung microvascular endothelial cells (HMVEC-L) were seeded at 5000 cells/cm2 in EBM-2 with 5% FBS and EGM-2 supplement (all products, Lonza Bioscience) until reaching complete confluence 14 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and immortalized human Brain Microvascular Endothelial cells (HBMEC) were seeded at 5000 cells/cm2 in EBM supplemented with 5% FBS and EGM supplements (all products, Lonza Bioscience) until reaching confluence 42,43 ...
-
bioRxiv - Microbiology 2021Quote: ... The nucleofection reaction was placed in one well of a 16-well nucleofection strip (Lonza; Cat. No. V4XC-2032). The nucleofection strip was placed in the X-unit (Lonza ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 000 to 100 000 cells per reaction was then resuspended in 20uL of P3 solution (Lonza, V4XP-3032) and mixed by pipetting with the full gRNA-Cas9 complex mix previously assembled then added in the electroporation chamber well (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... the reaction was stopped by adding deactivated fetal calf serum (FCS; HyClone) and basic medium (1 % Penicillin/ Streptomycin (Lonza), 10 % FCS ...
-
bioRxiv - Immunology 2021Quote: ... 2×106 cells were nucleofected with 2μg of pcDNA3.1+ plasmid per reaction (Lonza-AMAXA program X-001, Nucleofector 2b). 24 hours after transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Biophysics 2021Quote: ... 10 pmol of the cholesterol-modified reverse primer and 1μL 20X SYBR® Green I Nucleic Acid Stain (Lonza) were mixed with the KAPA2G Fast HotStart ReadyMix in a total volume of 20 μL ...
-
bioRxiv - Cell Biology 2023Quote: ... 1xPenStrep (cat#XC-A4122, Biosera, Nuaille, France) and 1% nonessential amino acid (NEAA, cat#BE13-114E, Lonza, Basel, Switzerland) and maintained at 37 °C under 5% CO2 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... were ligated to the target fragments and full-length ligation products were purified via gel electrophoresis (2% MetaPhor agarose, Lonza, Basel, Switzerland). Purity and concentration of extracted fragments were determined using capillary electrophoresis (Fragment Analyser ...
-
bioRxiv - Molecular Biology 2020Quote: ... Gel electrophoresis after visual read-out of the LAMP assay was done by loading 5 µl of the lamp reaction with 5 µl 2x loading dye on a 1.5 % agarose (Seakem LE Agarose, Lonza #50004) together with 5 µl of a 1kB DNA Ladder (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2000 p mol of a degron-tagged control protein (mTagBFP2-RxxG) in a 100 µl nucleofection reaction (4D nucleofector kit SE plus supplement SF1, Lonza) 14 hours following nucleofection ...
-
bioRxiv - Neuroscience 2024Quote: ... 2.5 × 10 5 phNPCs cells were used per electroporation reaction in one cuvette of the 16-well Nucleocuvette Stripe (Lonza). After trypsinization ...
-
bioRxiv - Bioengineering 2024Quote: ... The transfection reaction was transferred into P3 Primary cell cuvette and electroporated with EO-115 program on a Lonza 4D Nucleofector (Lonza). The cells were rested in the cuvette without disturbing them for 15 minutes at RT ...
-
bioRxiv - Cell Biology 2024Quote: ... nucleofected in a 100 µl reaction using the Lonza 4D-Nucleofector System with P3 Primary Cell 4D-Nucleofector X Kit (Lonza) and program CA137 ...
-
bioRxiv - Biophysics 2024Quote: ... or 5-twist alone) were isolated by the separation of nicked knot reactions in 1% low-melting point agarose gels (SeaPlaque agarose, Lonza), followed by excision of specific bands ...
-
bioRxiv - Microbiology 2020Quote: ... Homogenate was resuspended with 6 ml per brain of prewarmed complete media (DMEM [Corning]; 10% FBS; 1% Nonessential Amino Acids Mixture 100x, [Biowhittaker Reagents Lonza],1% GlutaMAX supplement 100x [Thermo Fisher Scientific] ...
-
bioRxiv - Genomics 2021Quote: ... The EPCs were grown using EPC media (EGM-2MV supplemented with growth factors, ascorbic acid plus 20% Hyclone serum; CC-3202, Lonza and HYC-001-331G ...
-
bioRxiv - Cell Biology 2024Quote: ... Differentiation medium consisted of 50 % DMEM with pyruvate and 50 % BEBM supplemented with BEGM singlequots (except amphotericin B, triiodothyronine, and retinoic acid) (Lonza). Medium was supplemented with 100 nM all-trans retinoic acid (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... 190 μL was mixed with 10 μL of 20X SYBER Green I nucleic acid stain (Lonza Walkersville Inc, Walkersville, MD) in a well of a transparent 96-well plate and incubated in the dark for 15 minutes before being placed in the Guava easyCyte HT flow cytometer (488 nm ...
-
bioRxiv - Genetics 2023Quote: LCLs were treated with 2nM Retinoic acid for 24 hours prior to transfection of firefly and renilla luciferase constructs by Amaxa Nucleofector kit V (Lonza) with the X001 program on a Nucleofector II device ...
-
bioRxiv - Plant Biology 2024Quote: ... The nectar was also supplemented with 500 μL of BioWhittaker high non-essential amino acid mix (Lonza, Walkersville, MD, USA), as well as 1g DIFCO BACTO-Peptone (Becton Dickinson ...
-
bioRxiv - Cell Biology 2024Quote: ... prepared in tris-acetate (40 mM)/EDTA (10 mM) buffer and 5 μl of GelStar Nucleic Acid Stain 10,000 x (Lonza, 50535). 20 μl per sample resulting from PCR were mixed with Blue/Orange loading buffer loading dye 6x (PROMEGA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR products were then loaded and migrated by electrophoresis on a 3% Tris-borate-EDTA (TBE) agarose gel supplemented with GelStar Nucleic Acid Gel Stain (Lonza) for approximately one hour ...
-
bioRxiv - Cell Biology 2024Quote: ... confluent 293T-ΔNC cells were treated with a solution of 0.5 g/L trypsin and 0.2 g/L ethylene diaminetetraacetic acid (EDTA) without calcium or magnesium (Lonza; 17-161E) at 37°C to detach and dissociate the cells ...