Labshake search
Citations for Lonza :
1401 - 1450 of 1686 citations for hsa mir 146a Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The OPC cell cultures were regularly tested to be mycoplasma free using a MycoAlert Mycoplasma Detention Kit (Lonza, LT07-118). The OPCs were authenticated with immunopositivity for OPC cell markers (Nkx2—2 ...
-
bioRxiv - Microbiology 2022Quote: ... Both HPMEC and HUVEC cell lines were propagated (passages 5–10) and maintained in endothelial growth medium 2 (EGM-2) using the EGM-2 bullet kit from Lonza following the manufacturer’s specifications and grown in a CO2 incubator at 37°C with 5% CO2.
-
bioRxiv - Synthetic Biology 2022Quote: ... T cells were resuspended in P3 buffer (0.75-1 x 106 cells per 18 μl P3) from the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). 10 μg/μl Alt-R S.p ...
-
bioRxiv - Neuroscience 2022Quote: ... neurons were transfected by electroporation before seeding with target siRNA or ntRNA using a 4D-Nucleofector X Unit and the corresponding P3 Primary Cell nucleofection kit (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... transfection was performed with 3.5 μg of PF16eYFPNeo introduced into 108 cells using a Human T-cell kit and IIb Nucleofector set to program X-001 (Lonza). Other transfections described in this work used the same conditions except with Tb-BSF buffer (90 mM sodium phosphate ...
-
bioRxiv - Immunology 2022Quote: ... Electroporation was performed using the Amaxa P3 Primary Cell 96-well Nucleofector kit and 4D-Nucleofecter (Lonza, Walkersville, MD, USA). crRNAs were selected from CRISPR sgRNA database of (Genscript ...
-
bioRxiv - Cancer Biology 2022Quote: ... Generation of the MDA-MB-231 HAS overexpressing cells was conducted using either the pPB huHAS2-IRES2-mScarlet-IRES2-NeoR or pPB huHAS3-IRES2-mScarlet-IRES2-NeoR or with the Piggybac transponase using the Nucleofector Cell Line Kit V (Lonza). Stably transfected cells were selected using 1 μg/mL puromycin (MilliporeSigma ...
-
bioRxiv - Neuroscience 2022Quote: Neurons were nucleofected with identified plasmids prior to plating at 0 DIV using Amaxa Rat Neuron Nucleofector kit (DGP-1003; Lonza) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Two million of MNCs were transfected with 10 μg of plasmid (5:1 ratio pEB-C5:pEBTg) as instructed by the Lonza CD34+ nucleofector kit (VPA-1003, Lonza) and Amaxa nucleofector (program T-016 ...
-
bioRxiv - Immunology 2023Quote: ... isolated WT P14 CD8+ T cells were washed with PBS and mixed with RNPs by using P3 Primary Cell 4D-NucleofectorTM X Kit (Lonza) immediately prior to electroporation (Lonza 4D-nucleofactorTM core unit ...
-
bioRxiv - Neuroscience 2023Quote: ... 01F49i-N-B7 iPSCs were dissociated to single cells and 250,000 cells transfected with 25 μL of the prepared transfection mix containing 20 µL of nucleofection buffer (P3 Primary Cell 4D-NucleofectorTM X Kit S, Lonza), 5 µL of the RNP complex ...
-
bioRxiv - Immunology 2023Quote: CRISPR–Cas9 gene knockout was performed by transient Cas9/gRNA (RNP) complex electroporation using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). On day 4 of culture ...
-
bioRxiv - Cancer Biology 2023Quote: ... twice and resuspended in Cell Line Nucleofector solution SF (16.4uL) with Supplement (3.6uL) (SF Cell Line 4D-nucleofector X Kit, Lonza, V4XC-2032). Alt-R SpCas9 nuclease (100pmol ...
-
bioRxiv - Neuroscience 2023Quote: Transfection of dissociated neurons was performed using the AMAXA Nucleofector system (program O.005) with the mouse neuron Nucleofector kit (Lonza) following the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in 90 µL of nucleofection solution (16.2 µL of Supplement solution mixed with 73.8 µL of SF solution from SF Cell Line 4D-Nucleofector™ X Kit L) (Lonza), transferred to the 15 µL RNP solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were resuspended in respective electroporation/nucleofection buffer (HEK293T cells and HepG2 SF Buffer (SF Cell Line 4D-Nucleofector X Kit, Lonza), Jurkat cells SE buffer (SE Cell Line 4D-Nucleofector X Kit ...
-
bioRxiv - Microbiology 2023Quote: Constructed plasmids encoding AS1-S were introduced into MDBK cells using Amaxa cell line Nucleofector kit R (Lonza, Kanagawa, Japan) with Amaxa Nucleofector II system in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: Transfections of K562 cells were performed using a Lonza Bioscience 4D-Nucleofector system and the SF Cell Line 4D-Nucleofector X kits (Lonza). For single nucleocuvettes (100 uL) ...
-
bioRxiv - Genomics 2023Quote: ... Neurons were nucleofected with 10 µ total DNA plasmid DNA using the AD1 4D-Nucleofector Y kit (Lonza V4YP-1A24) with the ED158 (iCell GlutaNeurons ...
-
bioRxiv - Microbiology 2023Quote: ... Ribonucleoproteins were introduced into 1 x 106 sub-confluent BLaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2000 p mol of a degron-tagged control protein (mTagBFP2-RxxG) in a 100 µl nucleofection reaction (4D nucleofector kit SE plus supplement SF1, Lonza) 14 hours following nucleofection ...
-
bioRxiv - Microbiology 2023Quote: ... amazonensis promastigotes using the Human T-Cell Nucleofector kit and the Amaxa Nucleofector electroporator (program U-033, Lonza, Basel, Switzerland), for integration into the 18S rRNA locus within the nuclear DNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were co-transfected with 2 µg of the CRISPR/Cas9 plasmid and 2 µg of ssODN (50 µM) using a Nucleofector II and Amaxa Nucleofector kits (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The dissociated GSCs (1 × 106 cells) were resuspended in 100 μl of supplemented solution of the Human Stem Cell Nucleofector Kit 1 (Lonza) containing a combination of the px458 plasmid targeting each gene and the ssODN and then electroporated using B-016 program of Nucleofector 2b (Lonza) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-6 million primary human keratinocytes were electroporated with 1 nmol siPools using the Amaxa human keratinocyte Nucleofector kit (Lonza) according to the manufacturer’s instructions and the T-018 program of the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Genetics 2023Quote: ... and cells were resuspended according to the protocol provided for the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024). Briefly ...
-
bioRxiv - Immunology 2023Quote: Hepatocytes (7×105 cells) were transfected with various plasmids (at 6 μM or indicated concentrations) using the Mouse/ Rat hepatocyte Nucleofector kit (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: Cas9-RNPs were transfected into cells by electroporation (SF Cell Line 4D-Nucleofector™ X Kit S (Lonza, #V4XC-2032)) ...
-
Efficient Methods for Target Gene Manipulation in Haematopoietic Stem Cell Derived Human NeutrophilsbioRxiv - Cell Biology 2023Quote: ... CD34+ HSPC selected as previously described were preconditioned in SFEM II and StemSpan cytokines for 72 hours and electroporated with the Cas9-gRNP mixture using the Human CD34+ Cell Nucleofector kit (Lonza) in a Lonza IIb Nucleofector using program U-008 ...
-
bioRxiv - Bioengineering 2023Quote: Approximately 0.25 × 106 U2OS.eGFP-PEST cells were nucleofected with 300 ng of Cas9 expression plasmid and 30 ng of eGFP-targeting gRNA expression plasmid using the SE Cell line 4D-Nucleofector X Kit (Lonza) and DN100 pulse program ...
-
bioRxiv - Bioengineering 2023Quote: ... and 50 ng of AcrIIA4 expression or 300 ng of Cas9-P2A-CSD-AcrIIIA4 plasmid and 30 ng eGFP-targeting gRNA expression plasmid using the SE Cell line 4D-Nucleofector X Kit (Lonza) and DN100 pulse program ...
-
bioRxiv - Cell Biology 2023Quote: Differentiated HL-60 cells were nucleofected with Amaxa Nucleofector II device and Amaxa Cell line kit V (Lonza, VACA-1003) and prepared for live-cell imaging using aslightly modified version of an existing protocol 96 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Two gRNA plasmids and pCas9 (D10)-GFP plasmid were nucleofected into cells using Basic Nucleofector Kit for Primary Mammalian Epithelial Cells (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... were delivered as a ribonucleoprotein complex with the DNA donor template using a Nucleofector 2b Device and the Human Stem Cell Nucleofector Kit 1 (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were nucleofected with 4 µg of the sgRNA-containing plasmid individually following the Amaxa Mouse ES cell Nucleofector kit recommendations (VPH-1001, Lonza). Later ...
-
bioRxiv - Genetics 2023Quote: LCLs were treated with 2nM Retinoic acid for 24 hours prior to transfection of firefly and renilla luciferase constructs by Amaxa Nucleofector kit V (Lonza) with the X001 program on a Nucleofector II device ...
-
bioRxiv - Cell Biology 2023Quote: ... hESCs were nucleofected with RNPs using the 4D-Nucleofector and P3 Primary Cell 4D-Nucleofector X Kit and program CB150 (Lonza). After 24□hours ...
-
bioRxiv - Cell Biology 2023Quote: ... Five million BJAB or OCI-LY1 cells were transfected with 2 μg plasmid DNA using the SF Cell Line 4D-Nucleofector X Kit L (Lonza) and the AMAXA Nucleofector biosystem (BJAB ...
-
bioRxiv - Developmental Biology 2023Quote: ... and co-transfected with an ssODN donor template containing the desired modification into H9/WA09 cells via nucleofection (Amaxa P3 primary cell 4D nucleofector X kit L, Lonza) using the manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2023Quote: ... 2.5e5 RPE1 CRISPRi cells were nucleofected with 3μM RNP complex using an SE Cell Line 4D X Kit S (Lonza Bioscience) on a 4D-Nucleofector (Lonza Bioscience ...
-
bioRxiv - Neuroscience 2023Quote: ... before being introduced to the KOLF2 hiPSCs through electroporation (P3 Primary Cell 4D-Nucleofector X Kit, Program CA-137, Lonza). The resulting clones were screened by multiplexed amplicon sequencing on an Illumina Mi-Seq platform with the MiSeq Reagent Kit V2 (Illumina) ...
-
bioRxiv - Biophysics 2023Quote: ... MCF7 and A375 cells (ATCC) were transfected with 1 μg DNA using the SF Cell Line 4D-Nucleofector kit (Lonza) following the manufacturer’s instructions via electroporation (4D-Nucleofector ...
-
bioRxiv - Neuroscience 2023Quote: ... The cell pellet was used for nucleofection using the P3 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-3024), a 4D-nucleofector core unit and X unit (Lonza ...
-
bioRxiv - Genomics 2023Quote: ... were purchased from ATCC and cultured in endothelial cell growth basal medium-2 containing bullet kit growth factor supplements (EBM-2 [endothelial cell growth basal medium-2]; Lonza), 5% fetal bovine serum ...
-
bioRxiv - Cell Biology 2023Quote: ... JAWS transfection was achieved using 20 μg DNA and 2 x 106 million cells per 100 μl nucleofection solution from the Amaxa Nucleofector Mouse Dendritic Cell kit (Lonza), and the Y-001 program ...
-
bioRxiv - Biochemistry 2023Quote: ... 100pmol synthetic pegRNA (IDT) and 50pmol sgRNA (IDT) using the P3 primary cell nucleofector kit (cat#V4XP-3032, Lonza Biosciences) and program EH-115 on an Amaxa 4D-Nucleofector ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were treated with mycoplasma removal agent (MP Biomedical) and tested monthly for mycoplasma contamination using MycoAlert Plus mycoplasma testing kit (Lonza). SeV Cantell strain was grown in 10-day-old ...
-
bioRxiv - Molecular Biology 2023Quote: ... spanning the whole SARS-CoV-2 genome was transfected into 2×106 HEK293T cells using the SF Cell Line 4D-Nucleofector-X Kit (Cat# V4XC-2012, Lonza) and the 4D-Nucleofector X Unit (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... T cells were washed with PBS and resuspended at 100x106 cells/mL in Lonza P3 Primary Cell 4D Nucleofector Kit buffer (Lonza). 1μg/1x106 cells of sgRNA (Agilent ...