Labshake search
Citations for Lonza :
1201 - 1250 of 1686 citations for hsa mir 146a Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... fixed after 12 days and stained according to the OsteoImage™ Mineralisation Assay Lonza kit (PA-1503, Lonza) protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2×106 iPSC single cells were transfected using the Amaxa Human Stem Cell Nucleofector® Kit 2 (Lonza) with 4 μg ...
-
bioRxiv - Cell Biology 2020Quote: ... EB3-mCherry construct (Stepanova et al., 2003) was transiently transfected using Amaxa Cell Line Nucleofector kit V (Lonza), program X-001.
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were regularly tested for mycoplasma contamination using a biochemical test kit (#LT07-318, Lonza, Switzerland) and were free of mycoplasma contamination.
-
bioRxiv - Cell Biology 2022Quote: ... 25 μg mRNA was transfected into 2.5 × 106 freshly thawed fibroblasts using Cell Line Nucleofector Kit V (Lonza) and AMAXA program X-001 following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of these dominant-negative Rab11 a and siRab11 a into mouse MΦs (RAW 264.7 cell line) were performed with Amaxa mouse macrophage nucleofector kit (VPA-1009, Lonza) and DharmaFECT 4 Transfection Reagent (T-2004-01 ...
-
bioRxiv - Immunology 2023Quote: Electroporation was performed to introduce siRNA into BMDCs using a mouse dendritic cell nucleofector kit (Lonza, Basel, Switzerland) and a Nucleofector 2b (Lonza) ...
-
bioRxiv - Immunology 2023Quote: ... The MPRA vector library was nucleofected into TPP macrophages (5µg vector into 5×106 cells) in 100μl nucleofection buffer (Human Macrophage Nucleofection Kit, Lonza) using a Nucleofector 2b (program Y-011) ...
-
bioRxiv - Developmental Biology 2023Quote: ... or pcDNA3.1(-) as a control using the AMAXA SG Cell line kit (4D-Nucleofector program EO-100; Lonza). Cells were further cultivated in DMEM/F12 supplemented with 10% FBS (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... beads were removed on day 3 followed by electroporation using the Human T Cell Nucleofector™ Kit (Lonza) and the Amaxa Nucleofactor® 2b (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... CRISPR reagents were transfected into iPSCs using the P3 Primary Cell 4D Nucleofector™ X Kit S (Lonza), as previously described (Deneault et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and resuspended carefully in 20ul 4D-Nucleofector™ Solution (SE Cell Line 4D-Nucleofector™ X Kit, Lonza). Thereafter ...
-
bioRxiv - Immunology 2023Quote: ... The P14 cell/Cas9/RNP mixes were transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Cell Biology 2023Quote: PC12 cells were transfected with 300 nM siRNA by electroporation using the Cell Line Nucleofector Kit V (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... 1 - 2.5 × 106 Jurkat T cells were resuspended in EP buffer from the Nucleofector® Kit V (Lonza). Cells were combined with 1.5 μg of donor plasmid in a reaction volume of 100 μL and electroporated on the Amaxa® Nucleofector® II using pulse code X-005.
-
bioRxiv - Immunology 2024Quote: ... 16.4µl P3 and 3.6µl Supplement Reaction solutions from P3 Primary Cell 4D X Kit S (Lonza V4XP-3032) were added ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 × 106 HEK293T cells were transfected using SF Cell Line 4D-NucleofectorTM X Kit S (Lonza, V4XC-2012) with 7 µg of 5’ modified donor ...
-
bioRxiv - Immunology 2023Quote: ... 1×10e6 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... and nucleofection was performed as per the manufacturer’s recommendations (Lonza, SG Cell Line 4D-Nucleofector X Kit S). Monoclonal isolation of the knockouts were performed by limiting dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... we used the 4D-Nucleofector system and Amaxa P3 primary Cell 4D-Nucleofector X Kit S from Lonza. The electroporation buffer used was P3 primary cell Nucleofector Solution with Supplement 1 (Lonza) ...
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kits (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Cell Biology 2020Quote: ... or a FOXO1-targeted siRNA (GAGCGUGCCCUACUUCAAGGA) using the Amaxa(tm) Basic Nucleofector(tm) Kit for Primary Mammalian Fibroblasts (Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... Two million WTC iPSC were nucleofected using an Amaxa nucleofector 2B and the Nucleofector Kit C (both from Lonza), 0.5 µg of each AAVS1 TALEN pair and 1 µg of the donor plasmid (see Figure S4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kit L (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cellular ATP levels were detected 20 h after glutamate exposure using the ViaLight™ Plus-Kit (Lonza, Verviers, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The cell density was counted and ∼2.5 × 105 cells were transfected with indicated constructs by using P3 Primary Cell 4D-Nucleofector X kit (Lonza). After transfection ...
-
bioRxiv - Genomics 2019Quote: The input library plasmids were electroporated into the K562 cells with Cell Line Nucleofector Kit V (Lonza, VCA-1003). For each electroporation ...
-
bioRxiv - Neuroscience 2019Quote: ... 8 × 105 cells were co-transfected with 3 µg plasmid-sgRNA construct and ssODN (0.6 µM final concentration) with Amaxa Human Stem Cell Nucleofector Kit 1 (Lonza) and program A-023 for the Amaxa Nucleofector Device II ...
-
bioRxiv - Genetics 2019Quote: ... Hela cells were electroporated with plasmids using Ingenio electroporation kit (SopaChem) and the Nucleofector™ II/2b device (Lonza). Cells were harvested 24h post-electroporation ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were transfected using the P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza-BioResearch, Cat #: V4XP-3032) and Amaxa™ 4D-Nucleofector™ (Lonza-BioResearch) ...
-
bioRxiv - Cell Biology 2019Quote: ... The cells were then mixed with 100uL of SE Cell Line 4D-Nucleofector® X Kit (Lonza, Basel, Switzerland) and transfected with 65nM siRNA diluted in MilliQ sterile-filtered water using the 4D-Nucleofector (Lonza ...
-
bioRxiv - Immunology 2019Quote: ... Pre-activated B cells were transfected using the P4 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-4024) in combination with the program DI-100 ...
-
bioRxiv - Immunology 2019Quote: ... Endotoxin concentrations were measured in all protein samples using the Limulus Amebocyte Lysate Kit – QCL-1000 (Lonza, Basel, Switzerland). The rMIC1 ...
-
bioRxiv - Genomics 2020Quote: ... 1 million U2OS cells were transfected using the Nucleofector 2b with 2 μg Plasmid DNA using kit V (Lonza) according the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: ... pPBCAG-hph and a PiggyBac Transposase vector using the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001). Transfected cells were selected with 200 μg/ml hygromycin B Gold (Ibian tech. ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5×106 EL16.7 TST ESCs were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001) using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’ ...
-
bioRxiv - Immunology 2021Quote: ... The siRNA duplexes were used to transfect purified human naïve B cells using the Human B Cell NucleofectorTM Kit (VPA-1001, LONZA). Transfected B cells were then stimulated with CpG ODN 2395 plus IL-2 and IL-21 for 96 h before genomic DNA extraction for analysis of Sμ-σδand Sμ-Sγ1 DNA recombination ...
-
bioRxiv - Neuroscience 2020Quote: ... 2×105 dissociated neurons were transfected with Lonza Nucleofector using the Basic Neuron SCN Nucleofector kit (Lonza, Basel, Switzerland). Transfected neurons were incubated for indicating days and processed for subsequent analyses.
-
bioRxiv - Cancer Biology 2021Quote: ... The siRNA transfections for primary BMDMs and pancreatic fibroblasts were performed using the Mouse Macrophage Nucleofector™ Kit (Lonza) and Nucleofector™ 2b Device (Lonza ...
-
bioRxiv - Cancer Biology 2020Quote: ... E4ORF1-transduced primary human umbilical vein endothelial cells (HUVECs) were cultured using the EGM-2 Bullet Kit (Lonza, Germany). All cell lines were kept at 37°C and 5% CO2 in a fully humidified incubator and negatively tested for mycoplasma by PCR.
-
bioRxiv - Systems Biology 2021Quote: ... Cells were transfected with 250 nM of siRNA and 1 μl of control pMax GFP (Nucleofector X kit, Lonza), using the CU-133 program ...
-
bioRxiv - Microbiology 2021Quote: ... berghei ANKA using the parasite nucleofector II kit and the Nucleofector II device with the U-033 program (Lonza). Transfected parasites were injected intravenously into 5 - 7 weeks old female ddY mice ...
-
bioRxiv - Microbiology 2021Quote: ... Relative adenylate kinase levels were measured on 40μL of supernatants via the ToxiLightTM Non-Destructive Cytotoxicity BioAssay Kit (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... pCAGIG-hA3A-BE3 plasmid was delivered into cells using SF Cell Line 4D-Nucleofector X Kit (Lonza, #V4XC-2032) using programme CA-137 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 x 106 NSCs were mixed with 2.5 µg of corresponding DNA using Amaxa P4 Primary Cell 4D-Nucleofector X Kit S (Lonza) with CA137 programme in a 4D-Nucleofector X Unit (Lonza) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 μg of DNA was used to transfect the cells using the Amaxa Cell Line Nucleofector kit (Lonza Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 300 pmol of HDR oligonucleotide was electroporated into one million HEK293 Flp-In T-Rex cells along with 2.5 μg each of pSpCas9(BB)-2A-Puro and BiP gRNA plasmid (Amaxa kit R, program A-24; Lonza). Immediately after electroporation ...
-
bioRxiv - Microbiology 2022Quote: ... and resuspended in 100 μL nucleofector solution at a concentration of 1.5 x 106 cells/100 μl following the instructions of the Nucleofector Kit V (Lonza). In vitro transcribed RNA (5 μg ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1 million cells were transfected with 2μg of donor vector and 2μg of each AAVS1 ZFN expression plasmids using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza). Cells were seeded in E8 medium supplemented with 10µM ROCK Inhibitor Y-27632 (Selleckchem) ...