Labshake search
Citations for Lonza :
1201 - 1250 of 1332 citations for 5 Bromo 2 bromo difluoro methyl 1H benzimidazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and cultured in 96-well culture plates (2×103 cells/well) with serum or EP-stimulated MDMs supernatants in X-VIVO 15 medium (Lonza) with 10 U/mL of IL-2 (PeproTech ...
-
bioRxiv - Microbiology 2023Quote: ... Stable cell lines were generated by nucleofecting 2 µg of pBud-PCID2-Flag plasmid or empty pBud as control using Amaxa Nucleofector (Lonza) and Nucleofector Kit R (Lonza ...
-
bioRxiv - Molecular Biology 2023Quote: ... MRTF-WT and MRTF knockout in NIH 3T3 (MRTF-KO-1 and MRTF-KO-2) cells were cultured in DMEM (BE12-614Q, Lonza) supplemented with 10 % Fetal Bovine Serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... spanning the whole SARS-CoV-2 genome was transfected into 2×106 HEK293T cells using the SF Cell Line 4D-Nucleofector-X Kit (Cat# V4XC-2012, Lonza) and the 4D-Nucleofector X Unit (Lonza ...
-
bioRxiv - Immunology 2023Quote: ... Mixtures of complexed sgRNA and Cas9 (0.3 nmol synthetic sgRNA + 62 µmol Cas9 nuclease) and 2-10×106 enriched murine CD8+ T cells were suspended in 25ul of P3 electroporation buffer (Lonza) and electroporated using the Lonza 4D Nucleofector (pulse code DN100) ...
-
bioRxiv - Bioengineering 2022Quote: ... 30 µl was mixed with 6 µl 6X gel loading dye and run on a 50 ml gel containing 2% SeaKem Agarose (Lonza), 1x Tris-Acetate-EDTA (Boston BioProducts) ...
-
bioRxiv - Bioengineering 2022Quote: ... Bone marrow mononuclear cells were plated in endothelial growth medium 2 + 10% fetal bovine serum (FBS) (EGM-2MV, Lonza, Switzerland) on fibronectin coated plates and cultured at 37°C in 5% CO2 incubators ...
-
bioRxiv - Cell Biology 2022Quote: ... Three slices were placed in one well of a 12-well plate and incubated with 2 mL DMEM (Lonza, #42430) with 0.6% amphotericin B ...
-
bioRxiv - Systems Biology 2022Quote: ... The red blood cell lysis was performed by resuspending the pellet in 2 ml sterile ACK (Ammonium-Chloride-Potassium) lysis buffer (ACK Lysing Buffer, Lonza) and incubating on ice for 5 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... washed three times in PBS and cultured on collagen-coated 6-well plates in endothelial growth medium (EGM-2, Lonza) composed of endothelial basal medium supplemented with 2% fetal bovine serum ...
-
bioRxiv - Genomics 2022Quote: ... cells (from two donors) were grown to 80% to 90% confluence in endothelial basal medium 2-MV with supplements (EBM; Lonza) and 5% fetal bovine serum (FBS ...
-
bioRxiv - Genomics 2023Quote: ... of the PCR products were analyzed by electrophoresis on a 2% Agarose S gel (Nippon gene) in 1× TBE buffer and stained with GelStar (Lonza). The remaining PCR product of the condition that displayed a single-band or near single-band product on the gel was double size-selected and purified using AMPure XP beads (Beckman coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... Five million BJAB or OCI-LY1 cells were transfected with 2 μg plasmid DNA using the SF Cell Line 4D-Nucleofector X Kit L (Lonza) and the AMAXA Nucleofector biosystem (BJAB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1×105 cells were grown in each well of 12 well culture plates in SkGM-2 BulletKit growth medium (Lonza) to >90% confluency under standard culture conditions of 37°C and 5% CO2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... we proceeded with 50% Basal media (+10uh/ml HGF) and 50% SkGM™-2 Skeletal Muscle Cell Growth Medium (Lonza). Subsequently ...
-
bioRxiv - Developmental Biology 2024Quote: ... A total of 2 × 104 cells were seeded in each well with 150 μl EC specific media (Lonza, CC-3202). TIFF images of capillary-like networks were captured using a Zeiss Axio Image M2 microscope equipped with a digital camera at 4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... resuspended in RDM to OD600 of ≈0.003 and several 1-µl drops of the diluted cell suspension was placed on an agarose pad prepared with RDM and 2% agarose (SeaPlaque GTG Agarose, Lonza). The agarose pad was surrounded with a gene frame (Thermo Fisher ...
-
bioRxiv - Immunology 2024Quote: ... siRNAs were added to 2 µM and electroporation was performed using the program U-001 on the 3D-Nucleofector (Lonza). The siRNAs targeting Clever-1 ...
-
bioRxiv - Microbiology 2024Quote: ... and 2.5µg of each of the sgRNAs were incubated together for at least 10 minutes at room temperature before nucleofection of iPSC cells occurred using a Human Stem Cell Nucleofector Kit 2 (Lonza). Cells were then plated at 25 cell/cm2 on 2x Cultrex-coated plates in mTeSR-Plus media with 1× CloneR supplement (STEMCELL Technologies) ...
-
bioRxiv - Immunology 2024Quote: ... 1-2*106 T-ALL cells were resuspended in 100uL P3 nucleofector solution (82 uL nucleofection solution + 18 uL supplement; Lonza P3 Primary Cell 4D-NucleofectorTM X Kit) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 4 µL SpCas9/gRNA RNP + 2 µL repair template (2 to 8 µg) + 2 µL primed cells (4E6 cells) + 10 µg pUC19 plasmid (used as carrier DNA) + SF buffer (Lonza) to a final volume of 24 µL ...
-
bioRxiv - Cell Biology 2024Quote: ... 100 µL aliquots (7 × 106 cells) were then transferred into 2 mm EP cuvettes and electroporated on an Amaxa Nucleofector I (Lonza). For A2780 cells ...
-
bioRxiv - Immunology 2024Quote: ... PBMC vials were thawed in the 37 °C water bath for 1-2 minutes and resuspended in warm X-VIVO 10 serum-free cell-media (Lonza). Samples were washed by centrifugation for 12 minutes at 1200 rpm at room temperature (RT) ...
-
bioRxiv - Bioengineering 2024Quote: ... Unlabelled HUVECs or HUVEC with a constitutive green fluorescent protein (GFP) reporter (CMV-GFP HUVEC, ATCC) were cultured in EGM-2 Bulletkit medium (Lonza) and used before 10 passages ...
-
bioRxiv - Neuroscience 2024Quote: ... The CD146-positive cells remaining in the column were collected and cultured on collagen type I-coated dishes in in endothelial basal medium (EBM-2, Lonza) supplemented with endothelial growth factors EGM-2 SingleQuots (Lonza).
-
bioRxiv - Cancer Biology 2024Quote: Whole bone marrow cells were obtained by flushing one femur with PBS 2% FBS followed by erythrocyte elimination with ACK Lysing Buffer (10-548E, BioWhittaker, Lonza). The remaining cells were filtered through 40 μm pore size cell strainer and counted ...
-
bioRxiv - Cancer Biology 2024Quote: Bone marrow cells were obtained by flushing two femurs of each NSG mouse with 2% FBS in PBS followed by erythrocyte elimination with ACK Lysing Buffer (10-548E, BioWhittaker, Lonza). Cells filtered through 40 μm strainer were counted and 1×106 cells/well were stained with Live/Dead Blue (Thermo ...
-
bioRxiv - Bioengineering 2024Quote: ... were transduced with a lentivirus to express tdTomato fluorescent protein (Vectorbuilder) and were cultured in EGM-2 media (Promocell or Lonza). Human astrocytes (Sciencell ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 11 mM glucose and 25 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) pH 7.4 (Lonza, Basel, Switzerland). The apical (AP ...
-
bioRxiv - Bioengineering 2024Quote: ... The mixture was transferred to a confocal plate and subsequently UV crosslinked at 15 mW/cm2 for 1 minute and cultured for 4 days in EGM-2 media (Lonza).
-
bioRxiv - Cell Biology 2024Quote: PC-3 cells (1 × 106 cells) were transfected with 2 μg of mGFP-GPI cDNA using a 4-D nucleofector (LONZA) and cultured in two 150-mm dishes until reaching approximately 100% confluence (2 × 107 cells) ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were cultured at 37°C and 5% CO2 in DMEM (H3BE12-604F/U1, Lonza Group AG [Cultek S.L.U, Madrid, Spain]) supplemented with 10% tetracycline-free FBS (631106 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Microbiology 2020Quote: ... The final extension step was extended for 5 minutes and product size was confirmed by electrophoresis with a FlashGel™ DNA Kit (Lonza, Basel, Switzerland). PCR products were then purified with the DNA Clean & Concentrator kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... were grown in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expanded in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 12.5% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... plates were incubated at 37°C for 30 minutes in blocking buffer (PBS with 1% BSA, 5% FBS, and 1% human AB serum (Lonza, Walkersville, MD, USA), washed three times in PBS with 0.05% tween 20 and incubated with a commercial anti-SARS-CoV-2 Spike antibody (1/1000 ...
-
bioRxiv - Immunology 2023Quote: ... Cells were cultured at 37°C with 5% CO2 and were regularly tested for mycoplasma contamination using the MycoAlert® PLUS Mycoplasma Detection Kit (Lonza, LT07-703), and authenticated by Microsynth ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were incubated at 37°C in a humidified incubator with 5% CO2 and frequently tested for mycoplasma contamination using MycoAlert™ detection kit (Lonza, LT07-118).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cells are spun at 1250 x g for 5 minutes and resuspended in 25 µl Lonza SF buffer (Lonza Cat. No. V4SC-2960) if cycloheximide selection will not be used or 200 µl of SF buffer if cycloheximide selection will be used.
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were incubated at 37°C in a humidified incubator with 5% CO2 and frequently tested for mycoplasma contamination using MycoAlert™ detection kit (Lonza, LT07-118).
-
bioRxiv - Synthetic Biology 2021Quote: ... and γδ T cells were activated at 1 x 106 cells mL-1 for 2 days in complete XVivo15 medium (Lonza) (5% fetal bovine serum ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated with enhancer (IDT, #1075915, final concentration 4 μM) in a nucleofector device (Lonza, Nucleofector 2; program D-032). Cells were incubated for 24 h to allow them to recover and then detached and cloned by serial dilution ...
-
bioRxiv - Immunology 2022Quote: ... The concentration of IL-2 was increased to 1000 IU/ml on day 7 and the expanded T cells were electroporated with the indicated mRNA at a concentration of 2 pg mRNA/cell on day 8 using 4D Nucleofector™ System (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... pcDNA3-JUP or empty vector were transfected into Caco-2 cells using SE Cell Line 4D-Nucleofector™ X Kit (Lonza) and an Amaxa 4D Nucleofector device from Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... expressing the human CD133 antigen45 was co-delivered with a PBase expression vector (2.5 μg) into 2 ⨯ 106 U251 cells using Nucleofector 2b (Lonza, Köln, Germany), followed by puromycin (500 ng/ml ...
-
bioRxiv - Bioengineering 2020Quote: 2 million UCB-MNC/mL were cultured in X-VIVO 15 serum-free cell-culture medium (Lonza Group Ltd, Basel, Switzerland), supplemented with 0.5 μg/mL of FMS-like tyrosine kinase-3 and 0.5 μg/mL of stem-cell factor ...
-
bioRxiv - Bioengineering 2022Quote: ... the basal channels of the Intestine Chips were first rinsed with endothelial cell culture medium consisting of stem cell medium supplemented with components from EGM™-2 MV Microvascular Endothelial SingleQuots Kit (CC-4147; Lonza), and then 50 μL HIMECS (450,000 cells/chip ...
-
bioRxiv - Genomics 2021Quote: ... The medium was changed to fresh fibroblast medium containing β-mercaptoethanol on day 2 and to a defined hepatocyte growth medium (HCM, Lonza) on day On day 6 ...