Labshake search
Citations for Lonza :
901 - 950 of 1332 citations for 5 Bromo 2 bromo difluoro methyl 1H benzimidazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: Human colorectal adenocarcinoma cell line Caco-2 were maintained in Dulbecco’s Modified Eagle’s Media (DMEM) (Lonza) and supplemented with 10% FCS (Fetal calf serum ...
-
bioRxiv - Biophysics 2024Quote: ... Young adult worms were placed on a thin layer of 2% agarose (Lonza, SeaKem LE agarose) prepared on a 24 × 55-mm coverslip (Matsunami Glass ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured for a maximum of 4 passages cultured in EGM™-2 (Lonza #CC-4176) in T-175 or T-75 culture flasks (Thermo ...
-
bioRxiv - Biochemistry 2024Quote: Human neuron cortical cells (HCN-2, ATCC, CRL-3592) were cultured in DMEM (Lonza, BE12-604F) supplemented with 4 mM L-glutamine (Biological Ind. ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Isolated NK cells were activated at 1 x 106 cells mL-1 for 5 days in XVivo15 medium (Lonza) with 5% fetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary XP-C patient fibroblasts XP168LV were cultured at 37°C in an atmosphere of 5% CO2 in Ham’s F10 medium without thymidine (Lonza) supplemented with 20% fetal calf serum and antibiotics.
-
bioRxiv - Cell Biology 2020Quote: ... mouse skeletal myoblasts were grown at 37°C with a 5% CO2 humidified atmosphere in Dulbecco’s Modified Eagle’s Medium with 4.5 g.L−1 Glucose (DMEM; Lonza Bioscience, Bâle, Zwitzerland), supplemented with 10% fetal Bovin Serum (FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... were grown at 37°C (5 % CO2) in supplemented DMEM: Dulbecco’s Modified Eagle’s Medium with 4.5 % glucose (Lonza, Visp, Switzerland) supplemented with 10 % fetal bovine serum (Gibco ...
-
bioRxiv - Genomics 2020Quote: ... and 5×104 cells were resuspended in 20 μL SF electroporation buffer prepared with SF supplement (Lonza, Basel, Switzerland). 3 μL RNP complex solution was mixed with the cells and the cells were nucleofected using program DJ-110 on a 4D-Nucleofector (Lonza ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 × 106 of EGFP-PGCs were resuspended in a total volume of 100 μl Nucleofector Solution V (Lonza, Switzerland) premixed with 10 μg of Cas9 plasmid and the same amount of phiC31 integrase ...
-
bioRxiv - Genetics 2020Quote: ... 5μg vector (in 5μl) transfected into 5 million CD4 T cells in 100μl 1M nucleofection solution67) using a Nucleofector 2b device (Lonza; program V024 for resting T cells and T023 for stimulated T cells) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5×106 EL16.7 TST ESCs were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001) using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’ ...
-
bioRxiv - Cell Biology 2021Quote: Whole-mount Drosophila ovary samples (approximately 5 flies per experiment) were dissected into Grace’s insect media (Lonza, Walkersville, MD) and fixed for 10 minutes at room temperature in 4% paraformaldehyde in Grace’s insect media ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 μg of DNA was used to transfect the cells using the Amaxa Cell Line Nucleofector kit (Lonza Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Microbiology 2021Quote: ... was adjusted to OD600 of 2.5 (2.2 × 109 bacteria/mL) and the bacteria were then further diluted in serum-free XVIVO-15 medium (Lonza) prior to infection to obtain the respective multiplicity of infection (MOI) ...
-
bioRxiv - Immunology 2021Quote: ... Naive CD4+ T cells were cultured at 5% CO2/37°C in serum-free X-Vivo 15 medium (Lonza).
-
bioRxiv - Microbiology 2021Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP were formed by mixing 5 to 9 μgr base editor protein with 1.5 μgr of sgRNA in 20 μL of P3 buffer (Lonza, Amaxa P3 Primary Cell 4D-Nucleofector Kit ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Cancer Biology 2024Quote: ... Red blood cell lysis was performed for 5 min at room temperature in ACK lysing buffer (Lonza, #10-548E). For flow cytometry ...
-
bioRxiv - Microbiology 2022Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2024Quote: Human HeLa cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Genomics 2023Quote: ... Cells were grown at 37°C and 5% CO2 and passed with Hepes buffered saline solution (Lonza, CC-5024) and 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: Primary human alveolar epithelial cells (HPAECs, CellBiologics) were cultured at 37°C and 5% CO2 with SABM medium (Lonza), SAGM supplements (Lonza) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2023Quote: Plasma cholesterol was depleted by treating HEK293 cells with 5 mM MβCD for 30 min in Pro293A-CDM (Lonza); this short period of MβCD treatment was deemed sufficient to removed 50% of endogenous cholesterol from cells (34) ...
-
bioRxiv - Microbiology 2022Quote: ... and the well was gently washed once with 5 mL of phosphate buffered saline (PBS, Lonza, Rockland, ME, USA) to remove un-adherent floating bacteria ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were pelleted at 1000 rpm for 5 min and resuspended in 100 μL nucleofector solution (Lonza, #VPB-1002) before adding 2.5 μg of plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... were cultured at 37°C and 5% CO2 in EGMTM Endothelial Cell Growth Medium with BulletKitTM (Lonza CC-3124) and 1x antibiotic-antimycotic (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... Cas9-gRNA ribonucleoproteins were assembled as described previously53 and nucleofected into 5×106 monocytes in 100μL nucleofection buffer (Human Monocyte Nucleofection Kit, Lonza) using a Nucleofector 2b (Lonza ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Biochemistry 2024Quote: Human lung carcinoma A549 cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cell Biology 2024Quote: Primary human mammary epithelial cells (HMECs) were cultured at 37°C with 5% CO2 in MEBM basal medium (Lonza) supplemented with MEGM SingleQuots (Lonza ...
-
bioRxiv - Synthetic Biology 2021Quote: ... This mixture was nucleofected with 2×106 stimulated human primary T cells using the 4D-Nucleofector (Lonza) with the program EO-115 ...
-
bioRxiv - Genomics 2021Quote: ... PBMCs were then treated with 2 ml of erythrocytes lysis buffer (Lonza Walkersville inc. #120-02-070) for 1 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were cultured on laminin-coated tissue culture flasks in SKGM-2 medium (Lonza®, Valkersville, MD). Medium was replaced every 3 days ...
-
bioRxiv - Genetics 2020Quote: ... Parasites were subsequently resuspended in 100 μL nucleofector solution of the Basic Parasite Nucleofector Kit 2 (Lonza), combined with 50 μL plasmid solution containing 5-10 μg DNA ...
-
bioRxiv - Bioengineering 2021Quote: Human umbilical vein endothelial cells (ECs) were cultured in endothelial growth medium (EGM-2; Lonza, Basel, Switzerland) supplemented with 1% penicillin-streptomycin-fungizone (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... The overlay medium contained either DMEM with 2% FBS and 1% sea-plaque agarose (Lonza, Walkersville, MD) in the case of in vitro samples or Opti-MEM with 2% FBS ...
-
bioRxiv - Microbiology 2021Quote: Each transfection reaction was prepared by adding 2 µl of “primed” cells resuspended in SG buffer (Lonza) to a mixture of ...
-
bioRxiv - Cell Biology 2020Quote: ... were cultured at 1000-1500 cells/mm2 on 1% gelatin-coated dish in EGM-2 medium (Lonza) and used before passage 9 ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of plasmids were performed 2 days before experiments using the Amaxa nucleofector (Lonza VPD-1004). The cells were detached with trypsin/EDTA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 × 105 cells* ml) in 2 ml of Insect-Xpress medium (Lonza, Walkersville, MD, USA) were transfected with recombinant bacmids using Cellfectin reagent (Life Technologies) ...
-
bioRxiv - Neuroscience 2020Quote: ... in EBM-2 medium supplemented with EGM-2MV SingleQuots (Lonza, Cat No CC-3156 and CC-4147) in an incubator set to 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... the digested splenic cells were cultured in endothelial cell growth medium EGM-2 (Cat# CC-3162, Lonza) at a density of 2-5 × 104/mL in fibronectin-coated culture flasks for 24 hours ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Human umbilical venous endothelial cells (HUVECs) and EGM-2 bullet kits were obtained from Lonza (Basel, Switzerland).
-
bioRxiv - Cell Biology 2020Quote: ... Primary human pulmonary arterial smooth muscle cells (PASMCs) were cultured in SmGM-2 cell culture media (Lonza), and experiments were performed at passages 3 to 9 ...