Labshake search
Citations for Lonza :
1051 - 1077 of 1077 citations for IL 3 Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 6 µg of total plasmid DNA (2 µg for each of the three episomal vectors) were electroporated into 5×10^5 fibroblasts with the Amaxaμ Human Dermal Fibroblast Nucleofectorμ Kit (Lonza, Basel, Switzerland; VDP-1001). The fibroblasts were further cultured for 6 days to allow them to recover ...
-
bioRxiv - Microbiology 2020Quote: ... The previously described human proximal tubular epithelial cell line HPT-1b[26] was maintained in renal epithelial cell growth media (Lonza, cat. no. CC-4127). To generate the HPT-1b-mCherry cell line ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 3-4 hours later were transfected with 2 μg of pBabe KRAS WT and pBabe KRAS G12D or pBabe KRAS Q61H plasmid DNA by electroporation using the Amaxa® Human T Cell Nucleofector® Kit (Lonza, Basel, Switzerland) following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... 4−106 cells were pelleted at 300xg and then resuspended in 100 μL prewarmed nucleofector solution (Human Stem Cell Kit 1, Lonza, catalog no. VPH-5012); 4 μg of NGN2 plasmid and 1.5 μg each of 1R and 1L plasmids were added directly to the resuspended cells ...
-
bioRxiv - Bioengineering 2023Quote: ... Complete growth medium for culturing of human adipose derived stem cells (ASCs, ATCC SCRC-4000) consists of Lonza ADSC Basal Medium (Lonza, Lexington, MA PT-3273), 10% MSC FBS (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 199 (M199) medium (3: 1) supplemented with 10% fetal bovine serum (FBS),10 mM glutamine and penicillin-streptomycin (all from Lonza, Basel, Switzerland) and their purity was verified with the fibroblast marker TE-7 (Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza, Switzerland) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lines are cultivated at 37°C with 5% CO2 and were tested every 3 months for mycoplasma contamination using Universal Mycoplasma detection kit (ATCC, 30-1012K) or MycoAlert Plus Mycoplasma Detection Ki (Lonza, LT07-701). Cell lines were used no more than 30 passages.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A high resistance Plastiape® RS00 inhaler (Plastiape S.p.A, Osnago, Italy) containing size #3 HPMC capsules (V-Caps® Plus, Lonza, Morristown, NJ) and 1-3 mg of powder was attached to a USP induction port by a molded silicon adapter ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were seeded onto 96-well plates at a density of 3×104 cells per well in 100 μL cell culture media that consisted of DMEM (Lonza, Basel, Switzerland), 1% penicillin–streptomycin (Lonza ...
-
bioRxiv - Microbiology 2023Quote: ... Full-thickness samples were obtained by 12 mm punch and placed in 12-well plates containing 3 mL Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, Walkersville, MD, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Genomics 2024Quote: ... and electroporated with 6 μg of gRNA-Cas9 expression vector and 3 μg of SNRPN targeting vector using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3032). Transfected cells were plated into a 10 cm dish coated with Matrigel (Corning ...
-
bioRxiv - Immunology 2021Quote: Primary normal human bronchial epithelial cells (NHBECs) were obtained from a 65 year old Caucasian male without identifiers sourced from Lonza (NHBE CC-2540; Walkersville, MD). The NHBECs were revived from cryopreservation and expanded with PneumaCult™ Ex-Plus media (StemCell #05040 ...
-
bioRxiv - Cell Biology 2024Quote: Human primary lung microvascular endothelial cells (LMVECs) and pulmonary artery endothelial cells (PAECs) from different donors were purchased from Lonza (Walkersville, MD. See Table S1). Cells were seeded onto plates and cultured in complete medium comprising of endothelial basal medium-2 (EBM-2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested EBs were transferred to a tissue-culture treated 6-well plate (Falcon, #353224) in 3 ml of EB Differentiation media: X-VIVO 15 (Lonza Biosciences, #04-418Q) + 1% Glutamax (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Genomics 2020Quote: ... Human umbilical vein endothelial cells were isolated from umbilical cords of healthy donors after cesarean sections (HUVECS; n = 4; RWTH Aachen) (55) or obtained from Lonza (n = 3, Basel, Switzerland) (8) ...
-
bioRxiv - Genetics 2021Quote: Human embryonic microglia clone 3 (HMC3, ATCC® CRL3304™) cells were cultured in minimum essential medium (MEM) Eagle-EBSS with NEAA without L-Glutamine (Lonza, Cologne, Germany) supplemented with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Human umbilical vein endothelial cells (HUVEC) cells were grown at 37° C in the Endothelial cell basal medium-2 (LONZA #Cat No-CC-3156 and CC-4176) under the atmosphere containing 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: About three milligrams of AUG-3387 mAb dry powder was loaded into size #3 hydroxypropyl methylcellulose (HPMC) capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Genomics 2022Quote: ... 1.0µg/µl SpCas9-sgRNA-PGK-Venus construct and 1µg/µl donor construct were nucleofected into ∼3×106 Tir1 mESCs using the Amaxa™ 4D-Nucleofector and the P3 Primary Cell 4D-Nucleofector™ X Kit (Lonza, Cat. V4XP-3024) following the manufacture’s protocol ...