Labshake search
Citations for Lonza :
1001 - 1050 of 1140 citations for IL 3 Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... HMLE cells were generated by introducing SV40 large T-antigen and human telomerase reverse transcriptase into a primary culture of normal mammary epithelial cells (Lonza). HMLE cells were cultured in Mammary Epithelial Cell Growth Medium (Lonza) ...
-
bioRxiv - Immunology 2024Quote: ... and the GFPSpark and mCherry control vectors (DNA/cell ratio = 1.5 µg/106 cells in single transfections and 1.2 µg/106 cells in co-transfections) by using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 ...
-
bioRxiv - Immunology 2024Quote: For RNAi-mediated TSP-1 and TSP-4 silencing 4×106 3-day activated CD8+ T cells were transfected using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 with 150 pmol/106 cells of human TSP-1 and TSP-4-specific siRNAs (#s14108 and #s14100 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were thawed according to the supplier’s instructions and expanded in collagen-coated flasks in human stellate cell growth medium (Lonza, MCST250) supplemented with 50 μM 2-Phospho-L-ascorbic acid (Merck ...
-
bioRxiv - Molecular Biology 2019Quote: ... a modified antisense or control oligonucleotide (1 μM) was transfected into 3 × 106 cells using Nucleofector technology (Lonza) 16–18 h before the assay ...
-
bioRxiv - Biochemistry 2021Quote: ∼300 pairs of ovaries per replicate were harvested from 3-6 day old females in 1X PBS (Lonza) with 1 mM DTT (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... All cell lines were tested for mycoplasma every 3 months using MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland). All cells used were <20 passages from thaw.
-
bioRxiv - Immunology 2021Quote: ... and suspended at a concentration of 3 × 106cells/mL in RPMI-1640 (BioWhittaker®, Lonza, Walkersville, MD, USA) containing 15% heat-inactivated horse serum ...
-
bioRxiv - Molecular Biology 2021Quote: Inguinal white adipose tissue from 3-4 WT-C57Bl/6 male mice was collected and placed in Dulbecco’s modified eagle’s medium (DMEM; Lonza) supplemented with 1% Penicillin/Streptomycin (PS ...
-
bioRxiv - Neuroscience 2022Quote: ... Electrophoresis of 10 µl of RT-PCR products was performed using 3% agarose (SeaKem LE Agarose by Lonza) with molecular ladder gel containing 0.5 µg/ml ethidium bromide in x0.5 tris-acetate-ethylenediaminetetraacetic acid (TAE ...
-
bioRxiv - Cell Biology 2023Quote: Bone marrow derived DCs at day 7 (3×106) were transfected with 100μl of the Amaxa solution (Lonza) containing siRNA (control or target-specific ...
-
bioRxiv - Cell Biology 2023Quote: For immunoprecipitations performed on THP-1 cells were first transfected with 2 μg of empty vector pCDNA 3.1 or plasmid containing 3x FLAG_Vamp-3 using the Amaxa 4D nucleoporator system (Lonza) with the Amaxa SG Cell line kit and program FF-100 and following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were cultured less than 3 months after resuscitation and tested for contaminants using MycoAlert (Lonza) every 1-3 months to ensure they were free of Mycoplasma contamination.
-
bioRxiv - Biochemistry 2024Quote: ... 3×105 cells were electroporated using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza) with 400 ng donor DNA ...
-
bioRxiv - Cell Biology 2019Quote: ... HUVEC (primary Human Umbilical Vein Endothelial Cells, CC2517, LOT 0000482213) were maintained in Endothelial Cell Growth Medium Lonza (Lonza, CC-3121) with supplements and growth factors (Lonza ...
-
bioRxiv - Physiology 2019Quote: ... Human primary hepatocytes were provided by the Yale Liver Center Translational Core Facility and plated in HMM medium (Lonza, Basel, Switzerland) supplemented with 100 nM insulin ...
-
bioRxiv - Microbiology 2021Quote: Human airway epithelial cells including bronchial epithelia cells and small airway epithelial cells were purchased from Lonza (#cc-2540s; #cc-2547s), ATCC (#PCS-300-010 ...
-
bioRxiv - Immunology 2022Quote: ... were delivered into the CD4+ Human T cells by using Amaxa 4D-Nucleofector System and P2 Primary Cell 4D-Nucleofector® X Kit S (Lonza) according to manufacturer’s instructions using the pulse code EH100 ...
-
bioRxiv - Immunology 2019Quote: ... Leishmania tarentolae cells were transfected via electroporation (Nucleofector™ 2b Device, AmaxaTM Human T Cell Nucleofector™ Kit, Lonza, Basel, Switzerland) with the respective expression cassette containing the selective antibiotic marker Nourseothricin (NTC ...
-
bioRxiv - Neuroscience 2020Quote: ... along with Renilla luciferase control vector using a Human Stem Cell Nucleofector Kit according to the manufacturer’s instructions (Lonza, VPH-5012). Cells were plated in a 96-well plate and terminally differentiated into neurons ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 × 106 hiPS cells were nucleofected by Amaxa nuclefector device using Human Stem Cell Nucleofector® Kit 1 (VPH-5012, Lonza) and program B-016 with 4 μg of MyoD plasmid and 1 μg of the dual helper plasmid ...
-
bioRxiv - Developmental Biology 2022Quote: ... 400,000 H9 cells for each condition were electroporated with 1 μg plasmid via a human stem cell nucleofector™ kit (VPH-5012) by Lonza AMAXA Nucleofector 2B.
-
bioRxiv - Systems Biology 2024Quote: Human bone marrow MSCs (from seven donors, 18-25 years of age) were isolated from human bone marrow mononuclear cells (Lonza Biosciences) and cultured and phenotype-tested as described previously 10 ...
-
bioRxiv - Neuroscience 2024Quote: ... digested for 3 min at 37 °C in Accutase and then resuspended in 60 μL nucleofection buffer from the Human Stem Cell Nucleofector™ Kit 2 (Lonza). The suspension was combined 2 μM Electroporation Enhancer (IDTDNA ...
-
bioRxiv - Immunology 2024Quote: ... Jurkat T cells were transfected with ON-TARGETplus SMARTpool human Piezo1 siRNA or control siRNA (Horizon Discovery, previously Dharmacon) with SE Cell Line 4D-Nucleofector™ X Kit (Lonza). Jurkat T cells were used for the experiment after 24 h.
-
bioRxiv - Molecular Biology 2024Quote: ... HSVECs were obtained by enzymatic collagenase digestion of human saphenous veins (Ethics 15/ES/0094) and maintained in EC growth medium (EGM-2 BulletKit™) (Lonza) supplemented with foetal bovine serum (10% ...
-
bioRxiv - Cancer Biology 2023Quote: The human glioblastoma NCH601 cells (Schuster et al., 2020) were cultured as non-adherent spheres in DMEM-F12 medium (Lonza: 12634010) containing 1X Bit-100 (Provitro ...
-
bioRxiv - Bioengineering 2022Quote: ... for 1.5 h at 37°C and 5% CO2 before seeded with human umbilical vein endothelial cells (HUVECs, pooled donor, Lonza, Switzerland). Endothelial Cell Growth Medium-2 (EGM-2 ...
-
bioRxiv - Cell Biology 2024Quote: ... All human iPSC lines screened negative for mycoplasma contamination every other month using a MycoAlert PLUS detection kit (Lonza, LT07-710).
-
bioRxiv - Cancer Biology 2019Quote: ... NSCs were harvested with Accutase and 2-3×106 cells were resuspended in 100µl mouse neural stem cell nucleofector buffer (Lonza) with 2µg plasmid DNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)– 2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissues were washed 3-4 times over 1 hour in PBS (calcium- and magnesium-free; Lonza BioWhittaker #17-517Q) containing 0.1% Triton X-100 (PBT ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µL of the sgRNA (total 300 pmol) was added to 12 µL of SE buffer (Lonza V4XC-1032). In another well ...
-
bioRxiv - Biochemistry 2021Quote: ... For each nucleofection 3 x 106 cells were resuspended in 80 μl of mouse ES cell nucleofection solution (Lonza). Equimolar (0.32 nmol ...
-
bioRxiv - Bioengineering 2019Quote: K562 cells were transfected with two gRNAs targeting exon 1 and 3 of NGLY1 and Cas9 plasmid (lentiCas9-Blast) by Nucleofection according to the manufacturer’s protocol (Nucleofector, Lonza). LentiGuide-Puro (Addgene plasmid #52963 ...
-
bioRxiv - Cancer Biology 2020Quote: ... were used in passages 3-6 and cultured on 0.1% gelatin-coated tissue culture plates in complete EGM2 (Lonza) supplemented to a total of 10% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Genetics 2019Quote: The transfection of the HBMEC cells was carried out according to the same protocol but with 3 μg DNA for 0.5×106 cells in 100 μl cells of Cell Line Nucleofector Solution V (Lonza) with the program U-015 ...
-
bioRxiv - Bioengineering 2024Quote: ... and SK-BR-3 cells (Korean Cell Line Bank, Korea) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Lonza, Switzerland) supplemented with 10 % (v/v ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: A total of 3-4µg of plasmid DNA was electroporated into 3-4x106 early passage ES cells using the Amaxa Nucleofector II (Lonza) programme A-023 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma contamination was conducted every 3-4 weeks using the MycoAlert PLUS mycoplasma detection kit (Lonza).
-
bioRxiv - Biophysics 2023Quote: ... DNA samples were also analyzed by electrophoresis through 1.5 % and 3 % agarose gels (Seakem LE agarose, Lonza, Rockland, ME) in TAE (Tris-acetate + 1 mM EDTA ...
-
bioRxiv - Genetics 2024Quote: ... Approximately 2.5×105 CD34+ HSPCs were mixed with gRNA:Cas9 complexes and 3 µg ssDNA donor template (20 μL) in nucleofector strip format (Lonza). Electroporation was performed in Unit X ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary human Small Airway Epithelial Cells (CC-2547, Lot 501937) and primary human lung fibroblasts (CC-2512, Lot. 0000608197) were obtained from Lonza (Basel, Switzerland).
-
bioRxiv - Developmental Biology 2020Quote: ... cell line WTC11 (gift from Bruce Conklin, available at NIGMS Human Genetic Cell Repository/Coriell #GM25236) (Miyaoka et al., 2014) was electroporated (Lonza #VPH-5012) with a cloned nuclease construct containing a guide RNA (sgRNA1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: DNA delivery into human/mouse ESCs for CRISPR/Cas9 targeting were performed using a Nucleofector 2b Device (Lonza, Cat. No. BioAAB-1001). Human Stem Cell Nucleofector Kit 1 (Cat ...
-
bioRxiv - Developmental Biology 2020Quote: ... about 8 × 105 iPSCs were transfected with 5 μg of plasmids with Lonza Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012) on a Nucleofector 2b device (Lonza ...
-
bioRxiv - Genomics 2020Quote: ... THLE-2 cells derived from primary human liver epithelial cells were obtained from ATCC (Cat. CRL-2706) and grown in BEGM medium (Lonza; Walkersville, MD) supplemented with 10% fetal bovine serum ...