Labshake search
Citations for Lonza :
1001 - 1050 of 1276 citations for 7 NITRO 3 4 DIHYDRO 1H QUINOXALIN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were obtained from Lonza and maintained in endothelial cell basal medium-2 plus 1% FBS and essential growth factors (Lonza).
-
bioRxiv - Cancer Biology 2019Quote: ... while HUVEC cells were cultured for up to 6 passages in EGM-2 media (Bulletkit, Lonza) comprising all components ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary human skeletal muscle myoblasts (HSMMs) were cultured in growth medium (SkGM-2 Bullet Kit, Lonza). HEK293T cells (kindly gifted by Slimane Ait-Si-Ali lab ...
-
bioRxiv - Cell Biology 2020Quote: Live cells plated on glass coverslips were fixed with 2% paraformaldehyde (Acros Organic) in PBS (Lonza) for 20 minutes at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... NIH) in 100 µl IMDM/Glutamax/10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Bioengineering 2020Quote: ... ECs were suspended in EGM™-2 Endothelial Cell Growth Medium (Lonza,Basel, Switzerland CC-3162). Cells were cultured on 10 % matrigel coated microchannels and maintained in a humidified CO2 incubator at 37 °C and 5% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 5 were isolated from human nonparenchymal liver cells (NPCs) purchased from Lonza (cat# HUCNP) as described previously (Chen et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... young adult worms were placed on a thin layer of 2% agarose (Lonza, SeaKem LE agarose) on a 24 × 55-mm coverslip (Matsunami) ...
-
bioRxiv - Cell Biology 2021Quote: ... Young adult worms were placed on a thin layer of 2% agarose (Lonza, SeaKem LE agarose) prepared on a 24 × 55-mm coverslip (Matsunami) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... inactivated trypsin by adding 2 volumes of medium (500 ml DMEM (Lonza, Catalog no. BE12-733F), 55 ml FBS (PAN ...
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Cell Biology 2021Quote: ... LECs were cultured using the EGM2-Endothelial cell growth medium-2 bullet kit (Lonza, Basel, Switzerland). Cells up to 6 passages were used in in vitro experiments ...
-
bioRxiv - Molecular Biology 2021Quote: ... at a confluence of 80-90% were incubated for 24 hours with EBM-2 medium (Lonza) containing 1% FBS (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... Endothelial cells (104 cells/well) were treated with compounds in fully supplemented EGM-2 medium (LONZA) for 48 h and then analyzed as above.
-
bioRxiv - Bioengineering 2022Quote: ... as described before.[29] They were cultured in EBM™-2 basal medium (LONZA, CC-3156) that was supplemented with EGM™-2 SingleQuots™ supplements (LONZA ...
-
bioRxiv - Neuroscience 2023Quote: ... and the cell pellet resuspended in 2 ml of ACK lysing buffer (Lonza, Cat# 10-548E). After centrifugation ...
-
bioRxiv - Cell Biology 2023Quote: ... then the medium was replaced with hLSEC medium [EGM-2-MV microvascular endothelial cell medium (Lonza) supplemented with 50ng/mL recombinant human vascular endothelial growth factor-A (VEGF-A ...
-
bioRxiv - Immunology 2023Quote: ... with 0.05 mL blocking buffer (98% v/v FACS buffer (PBS + 2% v/v dFBS (Lonza)) and 2% v/v Fc receptor binding inhibitor (Thermo Fisher Scientific)) ...
-
bioRxiv - Immunology 2023Quote: ... 2 samples of 5x106 PBMCs were nucleofected in 100 mL of P3 buffer (Lonza; V4XP-3024) with 125 pmol of Alt-R Sp HiFi Cas 9 nuclease v3 (IDT ...
-
bioRxiv - Immunology 2023Quote: ... NIH) in 100 µl IMDM/Glutamax/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Bioengineering 2023Quote: ... which directly correlates to cellular metabolic activity.46 LSEC cells were maintained in EBM-2 (Lonza) media with EGM-2 BulletKit (Lonza) ...
-
bioRxiv - Biophysics 2023Quote: The pellet of cells after electroporation was mixed with 2 % (w/w) SeaPrep agarose (Lonza, Switzerland) in DMEM at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were embedded in a YEA medium solidified with 2% low melting temperature agarose (Lonza, #50101) on a polylysine-coated glass bottom dish (Matsunami ...
-
bioRxiv - Pathology 2024Quote: ... Glomerular and proximal tubular samples were plated in EGM-2 medium (CC-3162, Lonza, Walkersville, MD) and placed in a CO2-incubator for 30 minutes for the attachment.
-
bioRxiv - Bioengineering 2024Quote: ... cells were treated with various concentrations of BMP-2 or FK506 in an osteogenic media (Lonza). Cell culture medium was changed every 3 days ...
-
bioRxiv - Bioengineering 2024Quote: ... they were treated with various concentrations of BMP-2 or FK506 in an osteogenic media (Lonza). The medium was replaced every 3-4 days ...
-
bioRxiv - Immunology 2024Quote: ... an electroporation reaction consisted of 2 × 105 HEK293T cells in 20 μL of SF buffer (Lonza) and 2 μL of 20 μM Cas9 RNP (equivalent to 40 pmol final concentration) ...
-
bioRxiv - Immunology 2024Quote: ... NIH) in 100 µL IMDM GlutaMAX/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/mL human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested EBs were transferred to a tissue-culture treated 6-well plate (Falcon, #353224) in 3 ml of EB Differentiation media: X-VIVO 15 (Lonza Biosciences, #04-418Q) + 1% Glutamax (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Immunology 2021Quote: ... Buffy coat cells were washed three times in 2.5 mM EDTA-PBS at 4°C before dilution and maintenance in RPMI-1640 supplemented with 10% FCS (PAA, AT or Lonza, CH) 2 mM glutamine ...
-
bioRxiv - Genomics 2021Quote: The MPRA libraries were electroporated in 4 to 6 million cells each using the Nucleofector 2b or 4D (Lonza, Basel, Switzerland) with 6 µg of plasmid DNA and program T-030 or Y-001 and DS-132 ...
-
bioRxiv - Physiology 2022Quote: ... 5 million cells were washed with phosphate buffered saline (PBS) and electroporated with 4-6 μg of appropriate plasmid construct using an Amaxa cell nucleofector (Lonza laboratories) and nucleofection reagent (362.88 mM ATP-disodium salt ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Genetics 2021Quote: Human embryonic microglia clone 3 (HMC3, ATCC® CRL3304™) cells were cultured in minimum essential medium (MEM) Eagle-EBSS with NEAA without L-Glutamine (Lonza, Cologne, Germany) supplemented with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... This mixture was nucleofected with 2×106 stimulated human primary T cells using the 4D-Nucleofector (Lonza) with the program EO-115 ...
-
bioRxiv - Cell Biology 2019Quote: ... Mycoplasma testing was performed on a regular basis (every 2 weeks) using the Mycoalert Detection Kit (Lonza).
-
bioRxiv - Genomics 2021Quote: ... PBMCs were then treated with 2 ml of erythrocytes lysis buffer (Lonza Walkersville inc. #120-02-070) for 1 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were cultured on laminin-coated tissue culture flasks in SKGM-2 medium (Lonza®, Valkersville, MD). Medium was replaced every 3 days ...
-
bioRxiv - Genetics 2020Quote: ... Parasites were subsequently resuspended in 100 μL nucleofector solution of the Basic Parasite Nucleofector Kit 2 (Lonza), combined with 50 μL plasmid solution containing 5-10 μg DNA ...
-
bioRxiv - Bioengineering 2021Quote: Human umbilical vein endothelial cells (ECs) were cultured in endothelial growth medium (EGM-2; Lonza, Basel, Switzerland) supplemented with 1% penicillin-streptomycin-fungizone (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... The overlay medium contained either DMEM with 2% FBS and 1% sea-plaque agarose (Lonza, Walkersville, MD) in the case of in vitro samples or Opti-MEM with 2% FBS ...
-
bioRxiv - Microbiology 2021Quote: Each transfection reaction was prepared by adding 2 µl of “primed” cells resuspended in SG buffer (Lonza) to a mixture of ...
-
bioRxiv - Cell Biology 2020Quote: ... were cultured at 1000-1500 cells/mm2 on 1% gelatin-coated dish in EGM-2 medium (Lonza) and used before passage 9 ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of plasmids were performed 2 days before experiments using the Amaxa nucleofector (Lonza VPD-1004). The cells were detached with trypsin/EDTA ...
-
bioRxiv - Neuroscience 2020Quote: ... in EBM-2 medium supplemented with EGM-2MV SingleQuots (Lonza, Cat No CC-3156 and CC-4147) in an incubator set to 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... the digested splenic cells were cultured in endothelial cell growth medium EGM-2 (Cat# CC-3162, Lonza) at a density of 2-5 × 104/mL in fibronectin-coated culture flasks for 24 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... while HMVEC-Lung and HMVEC-Colon were grown in EGM-2-MV medium (Lonza, Walkersville, MD, USA). Cells were used within 8 passages for all experiments.