Labshake search
Citations for Lonza :
851 - 900 of 1363 citations for 7 NITRO 3 4 DIHYDRO 1H QUINOXALIN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µL of the sgRNA (total 300 pmol) was added to 12 µL of SE buffer (Lonza V4XC-1032). In another well ...
-
bioRxiv - Biochemistry 2021Quote: ... For each nucleofection 3 x 106 cells were resuspended in 80 μl of mouse ES cell nucleofection solution (Lonza). Equimolar (0.32 nmol ...
-
bioRxiv - Bioengineering 2019Quote: K562 cells were transfected with two gRNAs targeting exon 1 and 3 of NGLY1 and Cas9 plasmid (lentiCas9-Blast) by Nucleofection according to the manufacturer’s protocol (Nucleofector, Lonza). LentiGuide-Puro (Addgene plasmid #52963 ...
-
bioRxiv - Cancer Biology 2020Quote: ... were used in passages 3-6 and cultured on 0.1% gelatin-coated tissue culture plates in complete EGM2 (Lonza) supplemented to a total of 10% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Immunology 2019Quote: ... washed once in PBS and resuspended in Mouse B cell Nucleofector Solution with Supplement (murine B cells) or Primary Cell Nucleofector Solution 3 with Supplement (human B cells) prepared to the manufacturer’s instructions (Lonza) at a concentration of 4 - 5 × 106 cells / 86 μL ...
-
bioRxiv - Genetics 2019Quote: The transfection of the HBMEC cells was carried out according to the same protocol but with 3 μg DNA for 0.5×106 cells in 100 μl cells of Cell Line Nucleofector Solution V (Lonza) with the program U-015 ...
-
bioRxiv - Bioengineering 2024Quote: ... and SK-BR-3 cells (Korean Cell Line Bank, Korea) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Lonza, Switzerland) supplemented with 10 % (v/v ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: A total of 3-4µg of plasmid DNA was electroporated into 3-4x106 early passage ES cells using the Amaxa Nucleofector II (Lonza) programme A-023 ...
-
bioRxiv - Cell Biology 2022Quote: Normal human bronchial epithelial cells (HBECs) from 3 independent donors (Supplemental Table S1) were obtained from Lonza (CC-2540) and cultured in BEGM growth media (Lonza CC-3170) ...
-
bioRxiv - Biophysics 2023Quote: ... DNA samples were also analyzed by electrophoresis through 1.5 % and 3 % agarose gels (Seakem LE agarose, Lonza, Rockland, ME) in TAE (Tris-acetate + 1 mM EDTA ...
-
bioRxiv - Genetics 2024Quote: ... Approximately 2.5×105 CD34+ HSPCs were mixed with gRNA:Cas9 complexes and 3 µg ssDNA donor template (20 μL) in nucleofector strip format (Lonza). Electroporation was performed in Unit X ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with the Endothelial Growth Medium (EGM-2) bullet kit (CC-3162, Lonza) and 1x antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were then starved overnight in EBMTM-2 basal medium (Lonza cc-3156) containing 1% FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were cultured in Endothelial Cell Growth Medium-2 BulletKit (CC-3162, Lonza) with 100 U/ml Penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were supplemented with EGM−-2 endothelial cell growth medium (Lonza, Basel, Switzerland). Cells were passage at 70 – 80 % confluency ...
-
bioRxiv - Bioengineering 2020Quote: ... were cultured with the Endothelial Cell Growth Medium-2 BulletKit (Lonza CC-3162) All cultures were maintained at 37°C ...
-
bioRxiv - Bioengineering 2020Quote: ... These cells were cultured and maintained in EGM-2 Bulletkit (CC-3162, Lonza). KLF2-GFP reporter cells were cultured M199 medium (12117F ...
-
bioRxiv - Cell Biology 2021Quote: ... Undifferentiated myoblasts were maintained in Skeletal Muscle Growth Media-2 (CC-3245; Lonza). 7.5 × 104 myoblasts were seeded on 30-mm dishes for immunocytochemistry ...
-
bioRxiv - Bioengineering 2021Quote: ... were grown in Fibroblast Growth Medium (FGM-2 BulletKit™, CC-3132, Lonza). Cells were cultured under a humidified incubator at 37°C and 5% CO2 and grown up to 80% confluency for experiments ...
-
bioRxiv - Microbiology 2020Quote: ... pre-warmed DMEM with 2 % FBS mixed with liquid SeaPlaque™ Agarose (Lonza) to a final concentration of 0.8 % agarose was added to cells two hours post infection ...
-
bioRxiv - Cell Biology 2019Quote: ... 500,000 Caco-2 cells were suspended in 100 μL buffer (Lonza #VCA-1002) supplemented with 264 pmol gRNA duplex ...
-
bioRxiv - Immunology 2020Quote: ... PBMCs were expanded for 2 weeks in X-vivo media (Lonza, BE02-060Q) supplemented with 5% human serum (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sorted cells were cultured in Endothelial Growth Media (EGM-2) (Lonza, Basel, Switzerland) on 2% gelatin-coated chamber slides ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 mM L-Glutamine and 100 U/ml Pen-Strep (all from Lonza). Cell lines were regularly tested for mycoplasma contamination ...
-
bioRxiv - Bioengineering 2022Quote: ... were obtained from Lonza (CC-2576) and cultured using SmGM™-2 BulletKit™ (Lonza CC-3182). All cells were from patients ranging in age from 30 to 65 years old and were sub-cultured according to Lonza’s recommended protocol.
-
bioRxiv - Biochemistry 2022Quote: ... grown to 1.6-2 million cells/ml in Insect-XPRESS media (Lonza™), were infected with P1 viral stocks at 16 ml/L ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with the Endothelial Growth Medium (EGM-2) bullet kit (CC-3162, Lonza) and 1x antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Bioengineering 2019Quote: ... Saos-2 cells (ATCC, UK) were cultured in McCoy’s 5A medium (Lonza, USA) supplemented with FBS (15% ...
-
bioRxiv - Genomics 2020Quote: ... The first consisted of 2 μl/well pmaxGFP DNA (LONZA,1 μg/ul) diluted in 250 μl/well Opti-MEM® medium (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... HSC-2 (JCRB0622) cells were cultured in EMEM (Eagle’s Minimum Essential Medium; Lonza), while HO-1-N-1 (JCRB0831 ...
-
bioRxiv - Immunology 2020Quote: RAW264.7 and 293 TLR4/CD14/MD-2 cells were cultured in DMEM (Lonza) supplemented with 10 % FBS (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were collected after two days in SKGM (SKGM-2, Lonza CC-3245) culture ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with Endothelial Cell Growth Medium (EGM)-2 Bullet Kit (CC-3162; Lonza)) ...
-
bioRxiv - Cell Biology 2021Quote: ... The hMBs were maintained in Skeletal Muscle Growth Media-2 (CC-3245; Lonza) as a growth medium for hMBs (hMB-GM) ...
-
bioRxiv - Cancer Biology 2021Quote: ... were obtained from Lonza and were cultured in EGM-2 SingleQuot Kit media (Lonza, cat #CC-3162) and used at passage 2-10 ...
-
bioRxiv - Microbiology 2021Quote: ... cells were overlaid with 1:1 mixture of 2% agarose (Lonza, Basel, Switzerland) and 2X MEM medium ...
-
bioRxiv - Bioengineering 2022Quote: ... that was supplemented with EGM™-2 SingleQuots™ supplements (LONZA, CC-4176), 10 % FCS and 1 % P/S ...
-
bioRxiv - Molecular Biology 2022Quote: ... HAECs were cultured in EBM-2 supplemented with singleQuots (LONZA, Clonetics CC-4176) and Endothelial Cell Growth Kit-VEGF (ATCC ...
-
bioRxiv - Microbiology 2022Quote: Human corneal epithelial cells (hTCEpi) (67) were cultured in KGM-2 (Lonza, USA) supplemented with 1.15 mM calcium chloride (high-calcium ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the recommended growth supplements (FGM™-2 SingleQuots™, CC-4126, Lonza). Primary human skin fibroblasts (2320 ...
-
bioRxiv - Bioengineering 2022Quote: ... LECs were cultured in EGM™-2 endothelial growth medium (Lonza, Basel, Switzerland). Primary HSCs were collected after selecting Kupffer cells and LECs ...
-
bioRxiv - Bioengineering 2023Quote: ... were cultured at 37°C and 5% CO2 with EBM-2 medium (Lonza) and EGM-2MV supplements in T-75 flasks until confluent ...
-
bioRxiv - Biophysics 2023Quote: ... 95% humidity and 5% CO2 in Fibroblast Growth Medium (FGM-2, Lonza, Basel).
-
bioRxiv - Bioengineering 2023Quote: ... cultured according to supplier’s directions in supplemented EBM-2 endothelial basal medium (Lonza); and normal human astrocytes (NHAs ...
-
bioRxiv - Physiology 2023Quote: ... Preadipocyte cells were maintained in preadipocyte growth media-2 (Lonza Cat #PT-8002). For experiments ...
-
bioRxiv - Physiology 2023Quote: ... Preadipocyte cells were maintained in preadipocyte growth media-2 (Lonza Cat #PT-8002).
-
bioRxiv - Cell Biology 2023Quote: ... Cells were cultured in Endothelial Cell Growth Medium-2 BulletKit (CC-3162, Lonza) with 100 U/ml Penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... Pre-adipocyte spheroids were maintained in pre-adipocyte growth medium (PGM-2, Lonza) containing 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK STIM1/2-/- were transfected via electroporation using the Amaxa Nucleofector II (Lonza) according to the manufacturer’s protocol ...