Labshake search
Citations for Lonza :
51 - 100 of 595 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 1% Non-Essential Amino Acid Solution (Lonza), 1% Sodium Pyruvate (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1X Non-Essential Amino acids (NEAA; Lonza). Cells were maintained in a humidified cell incubator ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM nonessential amino acids (Lonza, BW13114E), 0.005 mg/mL insulin (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... 0.1 mM non-essential amino acids (Lonza), 1 mM sodium pyruvate (Life technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1% non-essential amino acids (Lonza) at 37 °C in a 5% CO2 humidified environment.
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Genomics 2020Quote: ... and 1% non-essential amino acid solution (Lonza) at 37°C in a humidified atmosphere containing 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... 1% non-essential amino acids (Lonza BE13-114E), 0.2 mM myoinositol (Sigma I7508) ...
-
bioRxiv - Neuroscience 2020Quote: ... non-essential amino acids 2 % (Lonza, Bäle, Switzerland), FGF 1 ng/mL (PeproTech ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.1 mM non-essential amino acid solution (Lonza), and 1 mM sodium pyruvate (Lonza).
-
bioRxiv - Molecular Biology 2023Quote: ... 0.1 mM not essential amino acids (Lonza, BE13114E) and 100 U/ml Penicillin and Streptomycin (Euroclone ...
-
bioRxiv - Microbiology 2023Quote: ... and 1X Non-essential Amino Acids (NEAA, Lonza) (complete DMEM) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% of Non-Essential Amino Acids (NEAA; Lonza), and 10 μM of β-Mercaptoethanol (BME ...
-
bioRxiv - Physiology 2020Quote: ... supplemented with non-essential amino acids (1%, 100x Lonza), sodium-pyruvate (1% ...
-
bioRxiv - Cell Biology 2021Quote: ... ascorbic acid and heparin (EGM-2 SingleQuots Supplements, Lonza). Cells were grown in T-75 flasks ...
-
bioRxiv - Immunology 2021Quote: ... 1% (v/v) non-essential amino acids (NEAA) (Lonza), 2mM L-glutamine (Lonza) ...
-
bioRxiv - Immunology 2020Quote: ... 1% (v/v) MEM non-essential amino acids (Lonza), 100 U/ml penicillin ...
-
bioRxiv - Immunology 2022Quote: ... 1% 100x non-essential amino acid (Lonza #13-144E), 100 mM sodium pyruvate (Lonza #13-115E) ...
-
bioRxiv - Genomics 2022Quote: ... 100 μM non-essential amino acids (Lonza, #BE13-114E), 100 μM 2-mercaptoethanol (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... 1% non-essential amino acids (all reagents from Lonza) and 0.1% β-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... and 1% non-essential amino acids mixture (NEAA; Lonza). Cells were harvested using trypsin/EDTA (Sigma ...
-
bioRxiv - Pathology 2024Quote: ... ascorbic acid and heparin (EGM-2 SingleQuots Supplements, Lonza) medium without VEGF and reduced FBS (2% ...
-
bioRxiv - Cell Biology 2024Quote: ... Ascorbic acid (components of EGMTM SingleQuotsTM supplement kit, Lonza) 10% FBS (PAN Biotech ...
-
bioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with ascorbic acid (75 μg/mL, Lonza, #CC-4398), human recombinant insulin (20 μg/mL ...
-
bioRxiv - Microbiology 2024Quote: ... 1% (v/v) non-essential amino acids (Lonza, BE13-114E), and 1% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1X non-essential amino acids (NEAA; Lonza, 13-114E). Cells were maintained in exponential growth by passaging every 3-4 days.
-
bioRxiv - Immunology 2021Quote: Commercially available human primary PTs from 6 donors (3 males and 3 females, Lonza Walkersville Inc) were expanded at passage 4 ...
-
bioRxiv - Biophysics 2021Quote: ... HUVECs (Lonza, expanded to passage 3) were transduced with GFP tagged VE-cadherin (65 ...
-
bioRxiv - Microbiology 2022Quote: ... 100 µg/ml streptomycin and 1 % non-essential amino acids (Lonza) in a humidified incubator at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 100 µg/ml streptomycin and 1 % non-essential amino acids (Lonza) in a humidified incubator at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... and 3% FBS (all from Lonza Biosciences), termed astrocyte medium ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Dry powder (2-3 mg) was loaded into an HPMC size 3 capsule (VCaps® Plus, Lonza, Morristown, NJ). The capsule was placed in a Plastiape high resistance RS00 DPI that was then attached to a Next Generation Impactor (NGI ...
-
bioRxiv - Microbiology 2024Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
bioRxiv - Bioengineering 2024Quote: ... 1x MEM Non-Essential Amino Acids Solution (MEMNEAA) (Lonza, Cat no. 11140050), 1x GlutaMAX Supplement (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: Larvae were anesthetized with 0.02% ethyl 3-aminobenzoate methanesulfonate salt (Tricane, (E10521, Ethyl 3-aminobenzoate methanesulfonate) and mounted in 1% low melting point agarose (50100, Lonza) in a 60 mm x 15 mm petri dish ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with fetal calf serum (FCS, 3%, Lonza) and HEPES (1.8%) ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with fetal calf serum (FCS, 3%, Lonza) and HEPES (1.8% ...
-
bioRxiv - Microbiology 2023Quote: ... and 3 ml of ACK lysis buffer (Lonza) was added to the cells and incubated for 5 min ...
-
bioRxiv - Neuroscience 2024Quote: ... were nucleofected into 3 million cells by LONZA 4D-Nucleofector using program CB-150 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3% MetaPhorTM Agarose gels (Cat. No. 50181, Lonza) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% CO2 in EGM1 (Lonza) on 1% gelatin-coated flasks (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... Medium containing 5% FCS (Lonza) was used to expand and grow cells in a Cell Factory (6320 cm2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% non-essential amino acids and 10% fetal bovine serum (Lonza, NJ, USA). The media for ER+ cell lines were further supplemented with insulin (0.1 µg/ml) ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 10 mM N’-2-Hydroxyethylpiperazine-N’-2 ethanesulphonic acid (HEPES, Lonza), 2 mM Glutamax (Gibco) ...
-
bioRxiv - Neuroscience 2021Quote: ... embedded in 3% agarose (Lonza, # 50004, Rockland, ME, USA) and coronally sectioned (Leica VT1000S vibratome ...
-
bioRxiv - Biochemistry 2023Quote: Amino acid starvation treatment was carried out by incubating cells in HBSS buffer (Lonza) with 10% dialyzed FBS (Sigma Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 5% decomplemented FBS (Lonza), 1 M HEPES (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with horse serum (5%, Lonza), recombinant human insulin (5 ug/mL) ...