Labshake search
Citations for Lonza :
851 - 900 of 2381 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 µg of DNA were run on 0.75% agarose (Seakem ME Agarose, Lonza), dried under vacuum for 2 h at 50°C ...
-
bioRxiv - Developmental Biology 2024Quote: HUVECs were purchased from Lonza and cultured on gelatin-coated tissue culture dishes with EGM-2 culture medium (Lonza). Cells were used between passages 3 and 5 for experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... Passaging of iPSCs was carried out every 4-5 days using Versene (EDTA 0.02%) (Lonza, BE17–771E) solution for 3–5⍰minutes at 37⍰°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary uveal melanoma cells were equally divided onto two wells of a fibronectin-covered 6-well tissue culture plate and grown in 5% CO2 in MDMF medium which consists of HAM’s F12 (Lonza, Walkersville MD, USA) supplemented with 1 mg/mL BSA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Molecular Biology 2020Quote: ... at Day 3-4 of phase I culture were electroporated using P3 Primary Cell 4D NucleofectorTM X Kit (from Lonza) with program DZ100 (Bak et al. ...
-
bioRxiv - Immunology 2021Quote: ... 2.106 T cells were resuspended in 20 µl of nucleofection solution with 3 µl or 4 µl RNP and transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Murine T cells were electroporated using the DN110 program of 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Cell Biology 2021Quote: ... at a concentration of 10,000 units/l (penicillin) and 1 mg/l (streptomycin) and 2 mM L-glutamine (BioWhitaker, Lonza, 200 mM, cat. No. 17-605E), respectively ...
-
bioRxiv - Neuroscience 2021Quote: ... DRGs were then mechanically triturated and washed in a complete neurobasal A medium (NBA, Gibco® Invitrogen™ supplemented with 2% B27, 2mM L-glutamine and 1% antibiotics: penicillin + streptomycin, Lonza™ BioWhittaker™), before being plated in 35- mm petri dishes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), 10 percent heat-inactivated FBS (GE Healthcare Bio-Sciences) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), and 10 percent heat-inactivated FBS (Hyclone) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), and 10% heat-inactivated FBS (Hyclone).
-
bioRxiv - Microbiology 2020Quote: ... 1x nonessential amino acids (Lonza) and 20 µg ml-1 trypsin (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... amino acid (NEAA 100x Lonza) and Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Physiology 2022Quote: ... ascorbic acid (CC-4116C, Lonza), bovine brain extract (CC-4092C ...
-
bioRxiv - Molecular Biology 2022Quote: ... ascorbic acid (#CC-4116C, Lonza), bovine brain extract (#CC-4092C ...
-
bioRxiv - Cell Biology 2023Quote: ... non-essential amino acids (Lonza) and leukaemia inhibitory factor (1000 U/ml ...
-
bioRxiv - Microbiology 2024Quote: ... Erythrocyte cultures were established in 6 well plates using HL-1 medium (Lonza, Basel, Switzerland) supplemented with 20% human serum type A+ (Interstate Blood Bank) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting mixture was electrophoresed in NuSieve 3:1 agarose (Lonza 50091), and fragments sized 150-350 bp were excised and then purified using a MinElute Gel Extraction kit (QIAGEN 28604) ...
-
bioRxiv - Cancer Biology 2021Quote: ... batch 0000440546 and 0000442486) and cultured in EBMTM-2 Basal Medium (Lonza, Walkersville, MD, USA) with EGM-2MV Single Quots (Lonza ...
-
bioRxiv - Developmental Biology 2022Quote: ... myogenic progenitors were resuspended in skeletal muscle growth medium (SKGM-2, Lonza, Cat. CC-3245) with 10 µM ROCK inhibitor ...
-
bioRxiv - Genetics 2020Quote: ... 250 ng of plasmid per 2 × 105 cells was transfected using Amaxa solution SF (Lonza) and program CA-138 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2×106 fibroblasts were harvested and used in each transfection with a Nucleofector device (Lonza) according to the manufacturer’s protocol using the program T-20 and the Amaxa kit R (Lonza) ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM L-Glu (Lonza, #17-602E, 100 U/ml Pen/Strep (Lonza, #17-602E), 10 mM HEPES (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human umbilical vein endothelial cells (HUVECs) prescreened for angiogenesis were cultured in EGM-2 (Lonza). Breast cancer cells were cultured in MammoCult (Stemcell Technologies ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells (ATCC CCL-2) were grown in DMEM with glucose and L-glutamine (Lonza), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... K562 cells (2×105 cells/transfection) were transfected with an Amaxa 4D-nucleofector™ (Lonza) using the SF nucleofection kit (program FF-120 ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were cultured in endothelial cell growth medium (EGM-2 CC-3162, Lonza, Basel, Switzerland), supplemented with BulletKit (CC-4176 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human umbilical vein endothelial cells (HUVEC) cultured in endothelial growth medium (EGM-2, Lonza, UK) for fewer than 5 passages were used in all experiments ...
-
bioRxiv - Genomics 2020Quote: ... or 2×103 cells per well of a 96-well culture plate in DMEM (Lonza) supplemented with 10% (v/v ...
-
bioRxiv - Bioengineering 2020Quote: ... 2% (w/v) L-glutamine and 0.1% (w/v) Gentamicin-Amphotericin (#PT-3001; Lonza, Germany) with 5% CO2 in air at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... (304-05a) were cultured in endothelial basal medium (EBM)-2 (LONZA Clonetics™ CC-3156) with 5% fetal bovine serum (GIBCO) ...
-
bioRxiv - Cell Biology 2020Quote: ... HK-2 cells were nucleofected using Mirus nucleofection solution and T20 program of nucleofector (Lonza).
-
bioRxiv - Cell Biology 2020Quote: ... cells were fed every 2 days with cardiac fibroblast basal media (CFBM) (Lonza, CC-3131) supplemented with 75ng/mL bFGF ...
-
bioRxiv - Microbiology 2020Quote: Human intestinal epithelial Caco-2 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Lonza), supplemented with 0.5% penicillin-streptomycin (50 μg/mL-50 μg/mL ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Initiation of differentiation was done with Preadipocyte Differentiation Media (PDM-2) (Lonza, Cat: #PT-8002). Maintenance of differentiation was done with DMEM supplemented with 1.9 ng/mL Insulin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... were maintained and cultured in smooth muscle basal media (SmGM-2 BulletKit; CC-3182; Lonza). The media was supplemented with hEGF ...
-
bioRxiv - Bioengineering 2023Quote: ... HUVECs were maintained in EBM-2 MV BulletKit medium (CC-3156 and CC-4147; Lonza). HUVECs in passages 3-5 were used for all experiments.
-
bioRxiv - Bioengineering 2022Quote: ... Adipocyte spheroids were formed by culturing spheroids in pre-adipocyte differentiation medium (PDM-2, Lonza) containing 1% insulin ...
-
bioRxiv - Bioengineering 2023Quote: ... Human umbilical vein endothelial cells (HUVECs) were expanded in Endothelial Cell Growth Medium-2 (Lonza), harvested for use between passage P4- P6 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary BMECs derived from healthy bone marrow specimens were cultured in EBM-2 media (Lonza) supplemented with necessary cytokines (Lonza).
-
bioRxiv - Microbiology 2024Quote: ... were electroporated with 2 μg plasmid using pulse code FF-120 (Lonza Amaxa 4D Nucleofector). Cells were incubated for 10 minutes at room temperatue ...
-
bioRxiv - Developmental Biology 2024Quote: ... were cultured in fibroblast growth media supplemented with FGM-2 bullet kit (Lonza, CC-3132) All cells were maintained at 37°C and 5% CO2 ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured using EBMTM-2 Endothelial Cell Growth Basal Medium (Lonza Bioscience, Cat. # CC- 3156) supplemented with the EGMTM-2 Endothelial SingleQuotsTM Kit (Lonza Bioscience ...
-
bioRxiv - Microbiology 2024Quote: ... All endothelial cells were grown in Endothelial Growth Medium-2 BulletKitTM medium (EGM2) from Lonza and maintained at low passages as previously described.9 Normal human astrocytes (NHA ...
-
bioRxiv - Cell Biology 2024Quote: ... ASC52telo cells were cultivated in Endothelial Cell Growth Medium-2 (Lonza, Cat. no. CC-3162) supplemented with 4% FBS (Merck KGaA ...
-
bioRxiv - Bioengineering 2024Quote: ... were purchased at Passage 2 and cultured in mesenchymal stem cell basal medium (Lonza, CA) with mesenchymal cell growth supplement ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.