Labshake search
Citations for Lonza :
951 - 1000 of 2381 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 2 × 106 cells were suspended in 100 µL buffer (P3 Primary Cell 4D-Nucleofector X Kit, Lonza), mixed with 4 µg DNA and transfected using the 4D-Nucleofector program DN-100 ...
-
bioRxiv - Cell Biology 2024Quote: ... Eye enucleations were completed under aseptic conditions and maintained in EBM-2 media (CC-3156, Lonza, USA). All connective tissue was removed from the external part of the eyes and then the cornea ...
-
bioRxiv - Cell Biology 2024Quote: ... HMVEC-L were cultured in EGMTM-2MV Microvascular Endothelial Cell Growth Medium-2 BulletKitTM (Lonza, CC-3202) at 37°C ...
-
bioRxiv - Microbiology 2023Quote: Caco-2 cells (human intestinal epithelial cell line) were cultured in DMEM - Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: Primary NHLF were purchased from Lonza and subcultured for up to six passages in manufacturer supplied growth medium (FGM-2 BulletKit, CC3132, Lonza). The microtissues populated with NHLF were grown for 2 d before the addition of M2 macrophages at a ratio of 4:1 (M2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... M0 cells were then serum starved for 2 hours in X-VIVO™ hematopoietic cell medium (Lonza, Basel ...
-
bioRxiv - Neuroscience 2023Quote: ... HUVECs were transfected with 2 μg of RNF213 WT or R4810K construct using electroporation (Lonza, Basel, Switzerland), following the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2024Quote: ... ∼2 million cells were electroporated using the T-020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Cell Biology 2024Quote: ... HMVEC-L were cultured in EGMTM-2MV Microvascular Endothelial Cell Growth Medium-2 BulletKitTM (Lonza, CC-3202) at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... cells were thawed and expanded in EGM-2 endothelial cell growth medium (Lonza, cat. no. CC-3124) for two passages (P-2 ...
-
bioRxiv - Bioengineering 2024Quote: Human umbilical vein epithelial cells (HUVEC, ATCC) were cultured in GM-2 Endothelial Cell Growth Medium (Lonza) supplemented with 1% Pen-Strep at 37° C and 5% CO2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... M0 cells were then serum starved for 2 hours in X-VIVO™ hematopoietic cell medium (Lonza, Basel ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1 mM non-essential amino acids (Lonza), 1 mM sodium pyruvate (Life technologies ...
-
bioRxiv - Immunology 2021Quote: ... 100 μM non-essential amino acids (Lonza), 1 mM sodium pyruvate (VWR) ...
-
bioRxiv - Biophysics 2020Quote: ... 0.1 mM non-essential amino acids (Lonza), 1 mM sodium pyruvate (Life technologies ...
-
bioRxiv - Bioengineering 2021Quote: ... 100 uM MEM nonessential amino acids (Lonza), 1mM sodium pyruvate (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... 1X Non-essential Amino Acids (NEAA, Lonza), and 1x Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... 1X Non-Essential Amino acids (NEAA; Lonza). Cells were maintained in a humidified cell incubator ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM nonessential amino acids (Lonza, BW13114E), 0.005 mg/mL insulin (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... 0.1 mM non-essential amino acids (Lonza), 1 mM sodium pyruvate (Life technologies ...
-
bioRxiv - Molecular Biology 2021Quote: Telomerase human aortic endothelial cells (TeloHAECs) (ATCC, CRL-4052) were cultured in EBM-2 basal media (Lonza, 3156) supplemented with EGM-2 Bullet kit (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... counted and 2×106 cells were transfected using the Basic Nucleofector kit for primary neurons (VAPI-1003, Lonza) and the D-33 programme on the Amaxa Nucleofector II B device (Amaxa Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... three tendons were placed into 1mL of complete Fibroblast Growth Medium-2 (FGM; #CC-3132, Lonza, Basel, Switzerland) containing 0.075% w/v collagenase type 2 (C6885 ...
-
bioRxiv - Neuroscience 2022Quote: ... 20,000 cells were resuspended in 100 μL nucleofection buffer from Human Stem Cell Nucleofector™ Kit 2 (Lonza). Salsa6f-AAVS1 SHL plasmid Template (2 μg ...
-
bioRxiv - Bioengineering 2022Quote: ... The iECs were cultured in endothelial cell growth medium 2 kit supplemented into basal media (except hydrocortisone, Lonza) with 1x GlutaMax (ThermoFisher ...
-
bioRxiv - Bioengineering 2022Quote: ... VERO cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 2 mM glutamine (Lonza). Cells were dislodged ...
-
bioRxiv - Cell Biology 2022Quote: ... EGM-2 was then added to each well along with 200µl of normal human lung fibroblasts (CC2512, Lonza) at a concentration of 2×105 cells/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... at a density of 2 million cells/mL in serum-free cell culture medium (Lonza AG, Basel, Switzerland) supplemented with 0.5 μg/mL FMS-like tyrosine kinase-3 (Peprotech ...
-
bioRxiv - Microbiology 2024Quote: ... Agarose pads were prepared by pipetting 550 µL of M8T with 2% molten agarose (Lonza, Cat. no. 50081) into each quadrant of a 4-chamber glass-bottom dish (Cellvis ...
-
bioRxiv - Genomics 2023Quote: 2 × 105 HCT116-Cas9 and iPSC-iCas9 were resuspended in 20 µl SE cell line nucleofection solution (Lonza) (HCT116-Cas9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with a blue fluorescent protein (BFP)-tag were cultured in smooth muscle cell growth medium-2 (SMGM2) (Lonza). Human umbilical cord vein endothelial cells (HUVEC ...
-
bioRxiv - Biochemistry 2023Quote: ... Briefly, D.mel-2 cells (CRL-1963, ATCC) were grown at 25°C in Insect-Xpress medium (181562, Lonza) supplemented with 1% Pen/Strep (15140122 ...
-
bioRxiv - Bioengineering 2023Quote: ... were cultured using the EGM™-2 MV Microvascular Endothelial Cell Growth Medium BulletKit™ (Lonza, CC-3202), which contains hydrocortisone ...
-
bioRxiv - Genetics 2023Quote: ... 2−106 lymphoblastoid cells were suspended in 100 μL of Nucleofector C solution (VCA-1004, Lonza Cologne AG) with 0.6 μM RNAi and transfected with the Z-001 program according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: Human aortic endothelial cells (ATCC, Manassas, VA) were cultured in EGM-2 culture media (Lonza Walkersville, Basel, Switzerland) on 0.1% gelatin-coated plastic dishes until ∼80% confluence ...
-
bioRxiv - Genetics 2023Quote: VSMCs were cultured in SmGM-2 medium supplemented with SMBM growth factors (Lonza, CC-4149 and CC-3181) in gelatin-coated dishes and incubated at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2024Quote: ... We add 2-ml per well of the secondary overlay containing 1.5% Sekam ME Agarose (Lonza, Cat. # 50011), 2X EMEM (Quality Biological ...
-
bioRxiv - Bioengineering 2024Quote: ... The endothelial cells and fibroblasts were cultured in microvascular endothelial cell growth medium (MVECPRO2: Lonza EGM-2 MV) and fibroblast media (Stromal cells/fibroblasts ...
-
bioRxiv - Bioengineering 2024Quote: ... were co-transfected with 2 µg plasmid-expressing guide RNA using a stem cell nucleofector kit (Lonza, Amaxa). Multiple guide RNAs were used to generate a collection of isogenic mutant cell lines ...
-
bioRxiv - Genomics 2020Quote: ... Human umbilical vein endothelial cells were isolated from umbilical cords of healthy donors after cesarean sections (HUVECS; n = 4; RWTH Aachen) (55) or obtained from Lonza (n = 3, Basel, Switzerland) (8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells in passage 1 were trypsinized and resuspended (3 × 104 cells/mL) in BEGM** (Lonza, see Table S4 for details of media composition ...
-
bioRxiv - Cell Biology 2023Quote: ... 1xPenStrep (cat#XC-A4122, Biosera, Nuaille, France) and 1% nonessential amino acid (NEAA, cat#BE13-114E, Lonza, Basel, Switzerland) and maintained at 37 °C under 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... 6 mmol/L l-glutamine (Lonza®), and a mixture of penicillin/streptomycin (100U/100 μg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... and cells were isolated by centrifugation at 500 g for 5 min at 4°C followed by being treated with ACK Lysing Buffer (10-548E, Lonza Bioscience, Switzerland) to remove red blood cells ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cell pellet was resuspended in 1-5 ml ACK lysis buffer (Lonza), according to the pellet size ...