Labshake search
Citations for Lonza :
851 - 900 of 2158 citations for 20 Hydroxyecdysone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... Cell lines tested negative for mycoplasma (MycoAlert Mycoplasma Detection kit, Lonza).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... via an RBL-2H3-specific Amaxa Nucleofector Transfection Kit T (Lonza), as done in (Weatherly et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the Amaxa Cell Line Nucleofector Kit V (Lonza #VCA-1003) and following the recommended instructions for SH-SY5Y nucleofection ...
-
bioRxiv - Cell Biology 2022Quote: ... and tested for mycoplasma using MycoAlertTM PLUS Mycoplasma Detection Kit (Lonza). The cells were cultured under physiological oxygen (3%) ...
-
bioRxiv - Molecular Biology 2022Quote: ... PHH P3 buffer (P3 Primary Cell 4D-Nucleofector X Kit, Lonza) and primary human CD4+ T cells R buffer (Neon Transfection System) ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the SF Cell Line 4D-Nucleofector X kit L (Lonza). On Day 2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mycoplasma contamination was examined using the MycoAlert mycoplasma detection kit (Lonza). See SI Appendix ...
-
bioRxiv - Biophysics 2023Quote: ... SE Cell Line 4D-NucleofectorTM X Kit (V4XC-1024, Lonza, Germany) was used for transient transfections of plasmids encoding tdTomatoPrLD and Tagged-GFP⍺S according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: An Amaxa Nucleofector II Device and Nucleofector Kit (Lonza, VPH-5012) were used to transiently express 5 μg of GATA1 gRNA plasmid (gRNA sequence ...
-
bioRxiv - Cancer Biology 2023Quote: ... P3 Primary Cell 4D-Nucleofector X Kits (Cat#. V4XP-3032, Lonza), including 4D-Nucleofector Solution ...
-
bioRxiv - Molecular Biology 2023Quote: Electroporation was carried out using the NucleofectorTM Kit (LONZA # VPA-1010) according to manufacturer’s instructions and as further detailed in [14] ...
-
bioRxiv - Bioengineering 2023Quote: ... Mycoplasma contamination testing was done by MycoAlert Myocplasma Detection Kit (Lonza). MDA-MB-231 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were tested monthly for mycoplasma contamination using MycoAlert kit (Lonza). Lentiviral plasmids carrying control (5’-CCTAAGGTTAAGTCGCCCTCG-3’ ...
-
bioRxiv - Genetics 2023Quote: ... Mycoplasma was tested using the MycoAlert detection kit (Lonza, Rockland, ME). Cell identity was confirmed using short tandem repeats by PCR profiling ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were monthly checked for mycoplasma contamination (MycoAlert detection kit; Lonza). For live imaging ...
-
bioRxiv - Cell Biology 2023Quote: ... into HAP1 cells (1.5 × 106 cells) by Nucleofector Kit V (Lonza) with a Nucleofector device (Lonza ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... Cells are monthly checked for mycoplasma contamination (MycoAlert detection kit, Lonza). Transient transfections were conducted using Effectene reagent (Qiagen ...
-
bioRxiv - Systems Biology 2023Quote: ... SARS-CoV-2 was mycoplasma negative (Lonza MycoAlert Mycoplasma Detection Kit). All experiments in this study that utilized cultured SARS-CoV-2 were conducted in a biosafety-level 3 laboratory.
-
bioRxiv - Molecular Biology 2023Quote: ... K562 CRISPRi cells were nucleofected (SF Cell Line 4D kit; Lonza) with the RNP ...
-
bioRxiv - Cell Biology 2023Quote: ... using a Basic Nucleofector Kit for primary neurons (Lonza, VAPI-1003) as described (Scholz et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nucleofection Kit V Complete Solution and Nucleofector 2 were from Lonza. Phusion Plus PCR Master Mix was from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... and the SF Cell Line 4D-Nucleofector X Kit S (Lonza). Gene Knockout Kits v2 (Synthego ...
-
bioRxiv - Immunology 2023Quote: ... human T cell Nuclefactor kit (Lonza VPA # 1002, program # T-020) with 2ug of PGL4 firefly vector constructs along with 0.2 ug of PGL4 Renilla vector ...
-
bioRxiv - Immunology 2024Quote: ... using the Amaxa Mouse Dendritic Cell Nucleofector Kit (#VPA-1011, Lonza) as previously described (12 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and cultured in the appropriate media (SKBM-2 Bullet kit, Lonza, Basel ...
-
bioRxiv - Cell Biology 2024Quote: ... The Amaxa Mouse Macrophage Nucleofector Kit was from Lonza (Cologne, Germany). Gene-specific TaqMan primer-probe mixes used for quantitative real-time polymerase chain reaction (PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cell lines were monthly tested for mycoplasma using MycoAlert Kit (Lonza) and were sent for authentication by Eurofins genomics.
-
bioRxiv - Bioengineering 2024Quote: ... Cells were screened for mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza). The medium was removed and the cells were washed twice with warm PBS and fixed with 4% paraformaldyhde ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mycoplasma detection was routinely performed using the MycoAlert detection kit (Lonza) throughout this study ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell clumps were electroporated using Mouse/Rat Hepatocyte NucleofectorTM Kit (Lonza) and Amaxa Nucleofector® 1 device in the presence or absence of flagellin (1μg ...
-
bioRxiv - Cell Biology 2024Quote: ... along with the Human Stem Cell Nucleofector™ Kit 2 (Lonza). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... or by analysis with MycoAlert Mycolplasma Detection Kit (Lonza, LT07-418).
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were cultured at 37°C and 5% CO2 in DMEM (H3BE12-604F/U1, Lonza Group AG [Cultek S.L.U, Madrid, Spain]) supplemented with 10% tetracycline-free FBS (631106 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cells are spun at 1250 x g for 5 minutes and resuspended in 25 µl Lonza SF buffer (Lonza Cat. No. V4SC-2960) if cycloheximide selection will not be used or 200 µl of SF buffer if cycloheximide selection will be used.
-
bioRxiv - Molecular Biology 2023Quote: ... were grown in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expanded in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 12.5% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... plates were incubated at 37°C for 30 minutes in blocking buffer (PBS with 1% BSA, 5% FBS, and 1% human AB serum (Lonza, Walkersville, MD, USA), washed three times in PBS with 0.05% tween 20 and incubated with a commercial anti-SARS-CoV-2 Spike antibody (1/1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were used from passages 5-9 for the experiments and were cultured in endothelial cell growth Medium-2 (EGM™-2) Bulletkit™ (Lonza Bioscience) on pretreated tissue culture 6-well plate (VWR international) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Immunology 2019Quote: ... mice were reconstituted 4 hrs post-irradiation with 5 million donor bone marrow cells in 200 μl Hank’s Balanced Salt Solution (HBSS; Lonza, distributed by VWR, Lutterworth, UK), administered by intravenous injection into the tail vein ...
-
bioRxiv - Genetics 2023Quote: ... of sg1617 or sg1618 was mixed with 500 pmol (5 μM) of 3xNLS-SpCas9-SpCas9 protein and added electroporation buffer (Lonza 4D, cat# V4XP-3024) up to 25 μl in one tube ...
-
bioRxiv - Genetics 2023Quote: ... of sg1617 or sg1618 (see sequences of sgRNAs in Table S2) was mixed with 100 pmol (5 μM) of 3xNLS-SpCas9 protein and added electroporation buffer (Lonza 4D, cat# V4XP-3032) up to 5 μl in one tube ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... with the P3 primary cell 4D nucleofector kit L (Lonza LONV4XP-3024). Puromycin (Invivogen 10 mg/ml ...
-
bioRxiv - Biophysics 2022Quote: ... Electroporation was performed using the Amaxa Cell Line Nucleofector Kit V (Lonza) using the P-20 program ...
-
bioRxiv - Genomics 2020Quote: ... or nucleofection (SG Amaxa Cell Line 4D-Nucleofector Kit, Lonza, Basel, Switzerland). Mutation efficiency was assessed in bulk cultures via DNA extraction ...
-
bioRxiv - Genomics 2020Quote: ... The cells were transfected using the Mouse ES Cell Nucleofector Kit (Lonza) and Amaxa Nucleofector (Lonza ...