Labshake search
Citations for Lonza :
651 - 700 of 2158 citations for 20 Hydroxyecdysone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Cells were resuspended and transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution in a 25 µL electroporation cuvette (Lonza). Electroporation of GCaMP mutants was performed according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2020Quote: ... 3 x 107 bloodstream form cells were harvested by centrifugation and transfected with 5-10 μg of linearized plasmid DNA using an Amaxa Nucleofector II (Lonza) with program X-001 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution electroporation cuvettes (Lonza). Electroporation was performed according to the manufacturer instructions ...
-
bioRxiv - Immunology 2021Quote: ... of four genetically independent donors were grown as monolayers in 100% humidity and 5% CO2 at 37 °C in serum-free defined growth media (BEGM, Lonza). NHBEs (passage 3 ...
-
bioRxiv - Bioengineering 2020Quote: ... were cultured under standard incubation conditions at 37 °C and 5% CO2 in endothelial growth media (EGM BulletKit CC-3124, Lonza). For all imaging experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were maintained in culture at 37°C with 5% CO2 and regularly screened to ensure the absence of mycoplasma contamination (MycoAlert, Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were grown in a humidified incubator at 37°C with 5% CO2 and routinely tested for mycoplasma infection (MycoAlert, Lonza). The identity of the cell line was confirmed by DNA fingerprinting (Laragen ...
-
bioRxiv - Microbiology 2020Quote: ... was combined with 15 pmol total synthetic sgRNA (5 pmol each sgRNA) (Synthego) to form ribonucleoproteins (RNPs) in 20uL total volume with SE Buffer (Lonza). The RNP assembly reaction was mixed by pipetting up and down and incubated at room temperature for 10 minutes.
-
bioRxiv - Microbiology 2021Quote: ... duncani parasites were maintained in A+ hRBCs (American Red Cross) at 5% hematocrit in HL-1 base medium (Lonza 344017) supplemented with 20% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell lines were cultured in a humidified incubator at 37°C and 5% CO2 in Iscove’s modified Dulbecco’s medium (IMDM; Lonza, Basel, Switzerland) with 2 mM Ultraglutamine (Lonza) ...
-
bioRxiv - Bioengineering 2022Quote: Two donors of human mesenchymal stem cells (hMSCs) at passage 5-6 were seeded on mineralized collagen scaffolds for osteogenesis experiments (seeded separately, BM-17, Lonza, Maryland ...
-
bioRxiv - Immunology 2022Quote: ... activated-DC were washed twice in PBS 1X and put in culture with allogeneic naive CD4+ T cells (104 DC and 5×104 T) in X-VIVO 15 media (LONZA) for the indicated time ...
-
bioRxiv - Molecular Biology 2020Quote: ... Gel electrophoresis after visual read-out of the LAMP assay was done by loading 5 µl of the lamp reaction with 5 µl 2x loading dye on a 1.5 % agarose (Seakem LE Agarose, Lonza #50004) together with 5 µl of a 1kB DNA Ladder (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution in a 25-μL electroporation cuvette (Lonza). Cells were electroporated according to the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2019Quote: ... mCherry-transfected) were cultured at 37°C in 5% CO2 in EGM®-2 Endothelial Cell Growth Medium-2 (Lonza). Patient-derived glioblastoma multiform (GBM ...
-
bioRxiv - Genetics 2019Quote: For gene editing 2×106 ESCs were transfected with 2 μg Cas9-GFP-guide plasmid and 5 μl of 100 μM ssODN repair templates (180 bp, IDT ultrameres) using electroporation (Nucleofector, Lonza). Cells were resuspended in 100 μl of P3 solution (Lonza ...
-
bioRxiv - Microbiology 2019Quote: ... All experiments were done with cells at passage 2 to 5 and cells were regularly checked for mycoplasma contamination (MicoAlert Lonza).
-
bioRxiv - Cell Biology 2019Quote: ... HUVE cells were cultured in endothelial growth medium supplemented with 5% fetal bovine serum (FBS) and growth factors (EGM-2; Lonza). HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 ug of each construct were nucleofected into BTSC73 or BTSC147 using an AMAXA nucleofector 2b device (Lonza, #AAB-1001). The GFP and RFP positive cells were then sorted two days post-electroporation and plated clonally using FACSAria Fusion ...
-
bioRxiv - Genetics 2019Quote: ... They were then transfected by nucleofection with 5 μg DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the C-016 program (Amaxa Biosystems) ...
-
bioRxiv - Immunology 2021Quote: Human telomerase-immortalized corneal epithelial (hTCEpi) cells (26) were maintained at 37°C/5% CO2 in regular keratinocyte growth medium KGM-2 (Lonza). Prior to treatment ...
-
bioRxiv - Immunology 2021Quote: ... CD3/CD28 beads were removed 48 hours after stimulation and 5 × 106 CTLs were electroporated with 2 μg plasmid using 4D-Nucleofector (Lonza). Medium was changed 6 hours after nucleofection and transfected cells were used 24-36 hours after electroporation ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse embryonic fibroblasts (MEFs) or African green monkey kidney fibroblasts (COS7) were cultured (37°C, 5% CO2) in DMEM (Lonza), supplemented with 10% fetal bovine serum (Life Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... according to the manufacturer instructions and seeded at 5×105 cells/mL in RPMI-1640 media with L-glutamine (Lonza) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: BHK-21 cells (clone BSRT7/5) constitutively expressing the T7 RNA polymerase (21) were grown in Dulbeco Modified Essential Medium (Lonza) supplemented with 10% fetal calf serum (FCS) ...
-
bioRxiv - Molecular Biology 2023Quote: ... complexes for each peak to be deleted were prepared individually by mixing 120 pmol of sgRNA with 20 pmol of Cas9 protein (QB3 MacroLab, University of California, Berkeley) in 5 ul of P3 primary cell nucleofection buffer (Lonza) and incubated at room temperature for 15 minutes ...
-
bioRxiv - Microbiology 2023Quote: BHK-21 cells (clone BSRT7/5) constitutively expressing the T7 RNA polymerase47 were grown in Dulbeco Modified Essential Medium (Lonza) supplemented with 10% fetal calf serum (FCS) ...
-
bioRxiv - Cell Biology 2023Quote: HEK293T cells were grown in fifteen 25 cm2 flasks at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were used at passages 3-5 for experiments and cultured at 37°C and 5% CO2 in complete EC basal medium containing growth factors EGM2-Bulletkit (Lonza) to ensure a stable environment for optimal cell growth ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Cryopreserved PBMC (5 x 106/sample) were thawed in prewarmed RPMI-1640 media supplemented with L-glutamine (Lonza, Basel, Switzerland) + 10% FCS ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary MEC were cultured in endothelial growth media (EGM) containing 5% FBS with growth factors (EBM-2; Lonza, Basel, Switzerland) at 37°C in 5% CO2 ...
-
bioRxiv - Bioengineering 2023Quote: NIH/3T3 fibroblasts were cultured at 37 °C and 5% CO2 in low-glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Lonza, Basel, Switzerland) and 1% penicillin/streptomycin antibiotic ...
-
bioRxiv - Physiology 2024Quote: ... of six genetically independent donors were grown as monolayers in 100% humidity and 5% CO2 at 37 1C in serum-free defined growth media (BEGM, Lonza). NHBEs (passage 3 ...
-
bioRxiv - Cell Biology 2024Quote: ... Two million E14 ESCs were nucleofected with paired Kdm3b targeting and donor plasmids (5 µg each) using the Amaxa 4D-Nucleofector protocol (Lonza) and selected with blasticidin S hydrochloride (Research Products International ...
-
bioRxiv - Cell Biology 2022Quote: ... was induced in hVECs and pVECs on a 12-well plate using EGM™-2 MV Microvascular Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, #CC-3202), without VEGF ...
-
bioRxiv - Cell Biology 2019Quote: 4D-Nucleofector® X Kit (product V4XC-1032, Lonza)
-
bioRxiv - Molecular Biology 2019Quote: ... Amaxa Nucleofector™ Kits for Human Stem Cells (Lonza) was used according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... and the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-118) were used to ensure that all the cells used in this study were mycoplasma-free.
-
bioRxiv - Cancer Biology 2020Quote: ... biannually by MycoAlert Mycoplasma Detection Kit (LONZA; Verviers, Belgium).
-
bioRxiv - Cancer Biology 2020Quote: ... with the Cell Line Nucleofector® Kit V (Lonza) were used ...
-
bioRxiv - Genetics 2021Quote: ... REGM Renal Epithelial Cell Growth Medium SingleQuots Kit (Lonza), amphotericin B and P/S ...
-
bioRxiv - Immunology 2020Quote: ... and the SE cell line kit (Lonza, #V4XC-1024). The day before transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and P3 Primary Cell 4D-Nucleofector Kit S (Lonza) with the CA173 program ...
-
bioRxiv - Cancer Biology 2022Quote: ... Amaxa Cell Line Nucleofector Kit V (VCA-1003, Lonza), Precision Red Advanced Protein Assay (ADV02-A ...
-
bioRxiv - Cell Biology 2022Quote: ... with necessary supplements (MSCGM hMSC SingleQuot Kit) (Lonza, UK). According to the manufacturer ...
-
bioRxiv - Neuroscience 2020Quote: ... with Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza) using program DC154 ...
-
bioRxiv - Cancer Biology 2020Quote: ... were grown in EGM-2 SingleQuot Kit media (Lonza) and used at passage 4-6 ...
-
bioRxiv - Bioengineering 2021Quote: ... The SF Cell Line 4D X Kit S (Lonza) was used for K562s and the P3 Primary Cell 4D Kit (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: ... using Amexa Cell line kit V (Lonza; VACA-1003), following a pre-existing protocol101 ...