Labshake search
Citations for Lonza :
851 - 900 of 1265 citations for 2 Chloro 3 6 chlorohexanoyl pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza, Basel, Switzerland) supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2023Quote: Ha deposition was detected staining constructs sections (n≥10 from n≥3 chambers considering two different hACs and two different MSCs donors) with OsteoImage (Lonza) as detailed above ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza, V4XP-3012) and the CA-137 program ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Measured tissues originated from six F508del homozygous patients (CF patient #1: CF-AB0609, female, 31 years-old; CF patient# 3: #28388-0000450918, Lonza, male ...
-
bioRxiv - Cell Biology 2024Quote: ... together with a plasmid encoding the piggyBac transposase in a 3:1 ratio (vector:transposase) using the P3 Primary cell 4D-Nucleofector™ kit (Lonza). Prior to targeting ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... 3 x 106 freshly isolated monocytes or BMDMs were resuspended in 20 µl of P3 primary cell nucleofection buffer (Lonza). Cells were then added to the Cas9-RNP complexes ...
-
bioRxiv - Cancer Biology 2024Quote: ... were annealed to Cas9 protein (IDT) and the ribonucleoprotein complex was transfected into SKOV-3 cells using a 4D-Nucleofector (Lonza). Bulk transfected cells were checked by flow cytometry for successful knock-down ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR products were then loaded and migrated by electrophoresis on a 3% Tris-borate-EDTA (TBE) agarose gel supplemented with GelStar Nucleic Acid Gel Stain (Lonza) for approximately one hour ...
-
bioRxiv - Physiology 2024Quote: ... counted and 3.106 cells resuspended in 100 μl Nucleofactor R solution and electroporated with 3 µg of plasmid (pcDNA3 containing or not α7-5HT3 cDNA) using the Amaxa nucleofactor kit R (Lonza) according to the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The constructs were then transfected into WT OSCs and Δl(3)mbt-OSCs with Nucleofector Kit V (Lonza, VVCA-1003) using T-029 program and a NucleofectorTM 2b Device (Lonza) ...
-
bioRxiv - Microbiology 2024Quote: ... P.berghei schizonts were electroporated with 3 mg of each plasmid using the FI115 program on the Amaxa Nucleofector 4D (Lonza). Transfected parasites were promptly injected intravenously into BALB/c mice and were subjected to selection with 0.07 mg/mL of pyrimethamine in drinking water starting from day one post-infection ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cells were first electroporated with a PiggyBac-configured plasmid containing the Dox-inducible NbALFA-ABEL degrader cassette and a plasmid encoding the PiggyBac transposase at a 3:1 mass ratio via nucleofection (solution E with program CM138) according to manufacturer’s instructions (Lonza Inc.), followed by puromycin selection (5μg/ml ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The optimised sequences were used to design gBlocks with appropriate overhangs (Fig. 1-3) and cloned into pMAX-GFP plasmid from Lonza, digested with KpnI and SacI (Fig ...
-
bioRxiv - Bioengineering 2024Quote: SP8 or DP T cells were isolated as described above and stimulated in vitro using irradiated K562 CD19-CD137L aAPCs at a 1:3 aAPC:T cell ratio in X-VIVO™ 15 (Lonza), supplemented with 5% human AB serum (Cat ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3×106 live cells were resuspended with the RNP complex and 20 µL of P3 Primary Cell Nucleofector Solution (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... were added to 20 µL P3 buffer containing 1.6 × 105 Accutase-dissociated iPSCs and the nucleofection procedure was carried out in a 16-well Amaxa 4D cuvette (Lonza; Primary Cell P3, pulse code CA137). Cells were cultured for 3 days under cold-shock conditions (32 °C/5% CO2 ...
-
bioRxiv - Cell Biology 2020Quote: ... HPAEC cells were procured from Lonza (catalog # CC-2530) and cultured in Endothelial Basal Media-2 (Lonza catalog #: CC-3516) supplemented with endothelial growth factors optimized for aortic and pulmonary arterial endothelial cells (Lonza catalog # CC-3162) ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells (2 × 105) were resuspended with SF buffer (V4XC-2032, Lonza, Basel, Switzerland) and pulsed with purified SpyCas9 (20 pmol).
-
bioRxiv - Immunology 2020Quote: ... and transduced with lentivirus to express CAR (MOI=2) in X-VIVO 15 (Lonza) containing 10% FCS with 5 μg/mL protamine sulfate (APP Pharmaceuticals) ...
-
bioRxiv - Cell Biology 2020Quote: ... were grown in EGM-2MV (Microvascular Endothelial Cell Growth Medium-2) medium from Lonza Bioscience ...
-
bioRxiv - Immunology 2021Quote: ... coated dishes (5 ng/cm2) and cultured in Endothelial Growth Medium 2 (EGM2, Lonza) supplemented with 50 ng/mL VEGF with medium changes every other day until they reached confluency ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 mM L-glutamine and 50 units/ml penicillin/streptomycin (cDMEM; Lonza, Slough, UK). Soluble foam proteins were prepared as above ...
-
bioRxiv - Bioengineering 2021Quote: ... were maintained in 0.1% (w/v) gelatin-coated flasks with complete EGM-2 (Lonza) supplemented with 1% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Bioengineering 2020Quote: ... Fluidic lines were coated with 1% gelatin which was replaced by EGM-2 (Lonza) for up to 24 hours ...
-
bioRxiv - Bioengineering 2021Quote: ... Then cells were cultured in differentiation medium I consisting EBM-2 (Lonza, #CC-3156), 0.1% FBS ...
-
bioRxiv - Genetics 2021Quote: ... The cells were electroporated by using the Human Stem Cell Nucleofector Kit 2 (Lonza) and the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Cell Biology 2021Quote: ... Talin1&2 double null cells (Atherton et al. 2015) were cultured in DMEM:F12 (Lonza) supplemented with 10% FCS (Lonza) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the culture medium was replaced with 2 mL of DMEM-F12 (LONZA #12-719F) supplemented with 10 % FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... Control HUVEC and HUVEC Nucleolin KD were cultured in the EGM-2 medium (Lonza), at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... Hep-2 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Lonza or Gibco) supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2022Quote: ... were cultured in EBM-2 endothelial cell growth basal medium (Lonza, Bend, OR, USA) supplemented with EGM-2MV microvascular endothelial cell growth medium SingleQuots supplements (Lonza) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR reactions were run on a 2% agarose gel (NuSieve™ GTG™, Lonza) and the 200-400 bp region was excised and purified using a QIAquick Gel Extraction Kit (#28704 ...
-
bioRxiv - Immunology 2021Quote: ... hECs were grown in endothelial cell growth medium (EGM-2 Bulletkit; Lonza, Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting hiMPs were expanded in myoblast growth and proliferation media (Lonza; SKBM-2). All myogenic cells were differentiated in DMEM containing 2% horse serum ...
-
bioRxiv - Microbiology 2022Quote: ... were obtained from Lonza (Cat# CC-2527) and cultured with EGM-2-MV medium (Lonza, Cat# CC-3202). For preparation of the airway-on-a-chip ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were washed with PBS and replaced with SkGM-2 BulletKit growth medium (Lonza) containing quercetin dissolved in DMSO at the indicated concentrations for 72 hours under standard culture conditions ...
-
bioRxiv - Microbiology 2022Quote: ... were obtained from Lonza (Cat# CC-2527) and cultured with EGM-2-MV medium (Lonza, Cat# CC-3202). For preparation of the airway-on-a-chip ...
-
bioRxiv - Immunology 2022Quote: ... We used the Human Stem Cell Nucleofector Kit 2 (Lonza, catalog no. LONVPH-5022). After electroporation ...
-
bioRxiv - Immunology 2023Quote: HUVECs were maintained in EBM-2 culture media according to the manufacturer’s instructions (Lonza). NF-κB signalling and cytokine release assays have been described previously [21] ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were first cultured for initial proliferation in growth medium (SmGM- 2, Lonza). Then ...
-
bioRxiv - Bioengineering 2023Quote: Freestyle CHO-S cells were purchased from Thermo Scientific (Cat#R80007) and were expanded in PowerCHO 2 Serum-free Medium (Lonza BELN12-771Q) supplemented with GlutaMAX (Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 × 105 cells were resuspended in 17 μL of P3-supplemented nucleofection buffer (Lonza). We then added RNP mix ...
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... Cells were cultured in Endothelial Cell Growth Basal Medium-2 (EBM2) (Lonza, Basel, Switzerland) with 10% heat inactivated fetal bovine serum ...
-
bioRxiv - Microbiology 2023Quote: ... were obtained from Lonza (Cat# CC-2527) and cultured with EGM-2-MV medium (Lonza, Cat# CC-3202). For preparation of the airway-on-a-chip ...
-
bioRxiv - Immunology 2023Quote: ... Expanded Treg cells (2 × 106) were resuspended into P4 Primary Cell solution (Lonza Bioscience) and nucleofected with Cas9 protein and gRNAs ...
-
bioRxiv - Physiology 2023Quote: ... ciCMVEC were cultured in endothelial growth medium 2 microvascular (EGM2-MV; Lonza, Basel, Switzerland) containing 5% fetal calf serum but without vascular endothelial growth factor A or Gentamicin Sulfate-Amphotericin.