Labshake search
Citations for Lonza :
751 - 800 of 1265 citations for 2 Chloro 3 6 chlorohexanoyl pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 2×106 CD8+ T cells were re-suspended in P3 buffer (Lonza) containing RNP complex and enhancer DNA (IDT ...
-
bioRxiv - Molecular Biology 2024Quote: ... ASCs were cultivated in EGMTM-2 Endothelial Cell Growth Medium (Lonza, Switzerland) supplemented with 2 % FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... hMBs were maintained in Skeletal Muscle Growth Media-2 (CC-3245; Lonza) as a growth medium (GM ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... all from EGM™-2 SingleQuots™ Supplement Pack (CC-4176, Lonza) abiding by manufacturer’s instructions as well as 10% (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... were maintained in EGM-2 endothelial cell growth medium (Lonza, Basel, Switzerland). Cells were passaged at 70 – 80% confluency ...
-
bioRxiv - Cell Biology 2023Quote: ... with EGM-2 SingleQuots supplement kit (CC-4176, Lonza Clonetics, Fisher scientific). All experiments were performed using low-passage cells (passage 3-8) ...
-
bioRxiv - Immunology 2023Quote: ... 2×106 or 10×106 cells were resuspended with P3 buffer (Lonza) and mixed with 60 or 300 pmol TRAC RNP in a total volume of 20 or 100 μl ...
-
bioRxiv - Microbiology 2024Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
bioRxiv - Microbiology 2022Quote: ... Virus was removed and 2 mL of overlay media (EMEM 1X Lonza 12-684F ...
-
bioRxiv - Bioengineering 2022Quote: Human umbilical vein endothelial cells were grown in EGM-2 media (Lonza) at 37C and 21% O2 and 5% CO2 ...
-
bioRxiv - Bioengineering 2022Quote: hBMSCs were isolated from 2 donors of human bone marrow (Lonza, USA) and characterized as previously described [52] ...
-
bioRxiv - Microbiology 2022Quote: Transfection was performed using the Amaxa Basic Parasite Nucleofector Kit 2 (LONZA). All transfectants were selected by treating mice with 70 μg/mL pyrimethamine in their drinking water ...
-
bioRxiv - Immunology 2022Quote: ... culture flasks in growth medium (EGM-2 MV medium (Lonza, Basel, Switserland) supplemented with 2.5% fetal bovine serum (FBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... Pieces were mounted in 3.5 mm dishes in 2% agarose (Lonza, 50180) diluted in milliQ water (FunGI protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... HBMEC were transfected with lentivirus or siRNA in EGM-2 media (Lonza). HeLa (ATCC CCL-2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... For HUVEC cells EGM-2 endothelial cell growth medium (Lonza, CC-3162) was used and cells were kept under the same conditions as mentioned before ...
-
bioRxiv - Microbiology 2024Quote: Transfection was performed using the Amaxa Basic Parasite Nucleofector Kit 2 (LONZA). All transfectants were selected by treatment of mice with 70 μg/mL pyrimethamine in their drinking water ...
-
bioRxiv - Neuroscience 2024Quote: ... and transfected with 2 μg plasmid DNA using the 4D- Nucleofector (Lonza). The cells were recovered in RPMI-1640 medium (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... were maintained in endothelial cell growth medium (EGM™-2 BulletKit, Lonza) at 37 °C with 5% CO2 and used at passages 2 - 8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the generated constructs were immersed in Endothelial Growth Medium 2 (EGM2, Lonza) and cultured under submerged conditions in a controlled incubator environment for up to 5 days ...
-
bioRxiv - Bioengineering 2024Quote: ... except that HUVECs were cultured in EC-growth medium (EBM-2, LONZA). EC-growth medium was supplemented with Single quots (EGM-2 ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with EGM-2 MV SingleQuot Kit Supplements and Growth Factors (Lonza); 7 ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with EGM-2 MV SingleQuot Kit Supplements and Growth Factors (Lonza) at 37L°C with 5% CO2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... were purchased from Lonza Bioscience and were cultured in Endothelial Growth Medium-2 (cc-3162, Lonza) at 37°C and 5% CO2 ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissues were washed 3-4 times over 1 hour in PBS (calcium- and magnesium-free; Lonza BioWhittaker #17-517Q) containing 0.1% Triton X-100 (PBT ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µL of the sgRNA (total 300 pmol) was added to 12 µL of SE buffer (Lonza V4XC-1032). In another well ...
-
bioRxiv - Biochemistry 2021Quote: ... For each nucleofection 3 x 106 cells were resuspended in 80 μl of mouse ES cell nucleofection solution (Lonza). Equimolar (0.32 nmol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma contamination was conducted every 3-4 weeks using the MycoAlert PLUS mycoplasma detection kit (Lonza).
-
bioRxiv - Bioengineering 2024Quote: ... and SK-BR-3 cells (Korean Cell Line Bank, Korea) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Lonza, Switzerland) supplemented with 10 % (v/v ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: A total of 3-4µg of plasmid DNA was electroporated into 3-4x106 early passage ES cells using the Amaxa Nucleofector II (Lonza) programme A-023 ...
-
bioRxiv - Cell Biology 2022Quote: Normal human bronchial epithelial cells (HBECs) from 3 independent donors (Supplemental Table S1) were obtained from Lonza (CC-2540) and cultured in BEGM growth media (Lonza CC-3170) ...
-
bioRxiv - Biophysics 2023Quote: ... DNA samples were also analyzed by electrophoresis through 1.5 % and 3 % agarose gels (Seakem LE agarose, Lonza, Rockland, ME) in TAE (Tris-acetate + 1 mM EDTA ...
-
bioRxiv - Genetics 2024Quote: ... Approximately 2.5×105 CD34+ HSPCs were mixed with gRNA:Cas9 complexes and 3 µg ssDNA donor template (20 μL) in nucleofector strip format (Lonza). Electroporation was performed in Unit X ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Cell Biology 2024Quote: ... NHEKs (no later than passage 3) were cultured in KGM Gold Keratinocyte Growth Medium BulletKit (00192060, Lonza, Basel, Switzerland). For daily maintenance and subculturing of NHEKs ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with the Endothelial Growth Medium (EGM-2) bullet kit (CC-3162, Lonza) and 1x antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were cultured in Endothelial Cell Growth Medium-2 BulletKit (CC-3162, Lonza) with 100 U/ml Penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were supplemented with EGM−-2 endothelial cell growth medium (Lonza, Basel, Switzerland). Cells were passage at 70 – 80 % confluency ...
-
bioRxiv - Bioengineering 2020Quote: ... were cultured with the Endothelial Cell Growth Medium-2 BulletKit (Lonza CC-3162) All cultures were maintained at 37°C ...
-
bioRxiv - Bioengineering 2020Quote: ... These cells were cultured and maintained in EGM-2 Bulletkit (CC-3162, Lonza). KLF2-GFP reporter cells were cultured M199 medium (12117F ...
-
bioRxiv - Cell Biology 2021Quote: ... Undifferentiated myoblasts were maintained in Skeletal Muscle Growth Media-2 (CC-3245; Lonza). 7.5 × 104 myoblasts were seeded on 30-mm dishes for immunocytochemistry ...
-
bioRxiv - Bioengineering 2021Quote: ... were grown in Fibroblast Growth Medium (FGM-2 BulletKit™, CC-3132, Lonza). Cells were cultured under a humidified incubator at 37°C and 5% CO2 and grown up to 80% confluency for experiments ...
-
bioRxiv - Microbiology 2020Quote: ... pre-warmed DMEM with 2 % FBS mixed with liquid SeaPlaque™ Agarose (Lonza) to a final concentration of 0.8 % agarose was added to cells two hours post infection ...
-
bioRxiv - Immunology 2020Quote: ... PBMCs were expanded for 2 weeks in X-vivo media (Lonza, BE02-060Q) supplemented with 5% human serum (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sorted cells were cultured in Endothelial Growth Media (EGM-2) (Lonza, Basel, Switzerland) on 2% gelatin-coated chamber slides ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 mM L-Glutamine and 100 U/ml Pen-Strep (all from Lonza). Cell lines were regularly tested for mycoplasma contamination ...
-
bioRxiv - Bioengineering 2022Quote: ... were obtained from Lonza (CC-2576) and cultured using SmGM™-2 BulletKit™ (Lonza CC-3182). All cells were from patients ranging in age from 30 to 65 years old and were sub-cultured according to Lonza’s recommended protocol.
-
bioRxiv - Biochemistry 2022Quote: ... grown to 1.6-2 million cells/ml in Insect-XPRESS media (Lonza™), were infected with P1 viral stocks at 16 ml/L ...