Labshake search
Citations for Lonza :
801 - 850 of 2027 citations for 4 Bromo 3' 1 3 dioxolan 2 yl 2 fluorobenzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... Preadipocyte cells were maintained in preadipocyte growth media-2 (Lonza Cat #PT-8002). For experiments ...
-
bioRxiv - Physiology 2023Quote: ... Preadipocyte cells were maintained in preadipocyte growth media-2 (Lonza Cat #PT-8002).
-
bioRxiv - Cell Biology 2023Quote: ... Cells were cultured in Endothelial Cell Growth Medium-2 BulletKit (CC-3162, Lonza) with 100 U/ml Penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the recommended growth supplements (FGM™-2 SingleQuots™, CC-4126, Lonza). Primary human skin fibroblasts (2320 ...
-
bioRxiv - Bioengineering 2022Quote: ... LECs were cultured in EGM™-2 endothelial growth medium (Lonza, Basel, Switzerland). Primary HSCs were collected after selecting Kupffer cells and LECs ...
-
bioRxiv - Bioengineering 2023Quote: ... were cultured at 37°C and 5% CO2 with EBM-2 medium (Lonza) and EGM-2MV supplements in T-75 flasks until confluent ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 x 105 cells were resuspended in 20 µL Nuclofector Solution SF (Lonza), combined with the assembled Cas9 RNPs ...
-
bioRxiv - Cancer Biology 2023Quote: 2.5 x 105 HUVEC (< 6th passage) in 120 µL EGM-2 media (Lonza) were seeded in channel slides (µ-Slides 0.4 Luer ...
-
bioRxiv - Bioengineering 2022Quote: ... that was supplemented with EGM™-2 SingleQuots™ supplements (LONZA, CC-4176), 10 % FCS and 1 % P/S ...
-
bioRxiv - Molecular Biology 2022Quote: ... HAECs were cultured in EBM-2 supplemented with singleQuots (LONZA, Clonetics CC-4176) and Endothelial Cell Growth Kit-VEGF (ATCC ...
-
bioRxiv - Microbiology 2022Quote: Human corneal epithelial cells (hTCEpi) (67) were cultured in KGM-2 (Lonza, USA) supplemented with 1.15 mM calcium chloride (high-calcium ...
-
bioRxiv - Bioengineering 2022Quote: ... Pre-adipocyte spheroids were maintained in pre-adipocyte growth medium (PGM-2, Lonza) containing 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK STIM1/2-/- were transfected via electroporation using the Amaxa Nucleofector II (Lonza) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... on 0.2% gelatin-coated plates with EGM-2 bulletkit medium (Lonza, Basel, Switzerland), containing EBM-2 basal medium along with the EGM-2 singlequots kit components ...
-
bioRxiv - Physiology 2023Quote: ... Switzerland) and supplemented with Microvascular Endothelial Cell Growth Medium-2 Bullet Kit (Lonza).
-
bioRxiv - Neuroscience 2023Quote: ... The squares were incubated for 2 minutes with L7 hPSC passaging solution (Lonza). After aspirating the L7 solution ...
-
bioRxiv - Developmental Biology 2024Quote: ... supplemented with EBM-2 SingleQuot supplement and growth factor kit (Lonza CC-4176). DNA binding assays were performed using the CUT&RUN Kit from Cell Signaling Technologies (CST 86652 ...
-
bioRxiv - Developmental Biology 2024Quote: ... TeloHAECs (ATCC, CRL-4052) were cultured in EBM-2 media (Lonza, CC-3156) supplemented with EGM-2 bullet kit (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: ... and the same supplements plus 2 mM UltraGlutamine I (Lonza, BE17-605E/U1).
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with the EGMTM-2 Endothelial SingleQuotsTM Kit (Lonza Bioscience, Cat. # CC-4176) except for the provided FBS supplement ...
-
bioRxiv - Bioengineering 2024Quote: ... Skeletal Muscle Cell Growth Medium-2 (SKGM, CC-3245) was purchased from LONZA. Defatty acid BSA (dBSA ...
-
bioRxiv - Cancer Biology 2024Quote: ... MSC and/or iEC were suspended in Endothelial Basal Medium 2 (EBM2, Lonza) at the desired density (MSC ...
-
bioRxiv - Bioengineering 2024Quote: ... HUVECs were cultured in EGM-2 Endothelial Cell Growth Medium (Lonza, CC-3162) and used between passages 2 and 6 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were cultured in Endothelial Cell Growth Medium-2 BulletKit (CC-3162, Lonza) supplemented with 100 U/mL Penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... HUVEC cells were grown in EBM™-2 Basal Medium (Lonza, CC-3156) supplemented with 2% FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... The HUVEC were cultured in endothelial cell growth basal medium (EGM-2; Lonza) supplemented with EGM-2 MV SingleQuot Kit Supplements and Growth Factors (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: ... hRECs were cultured in EGM-2 BulletKit medium (Lonza, Basel, Switzerland, #CC-3162) supplemented with 2% fetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Conditioned media (containing EVs) was removed and the cells washed x 2 with PBS before trypsinisation using 1 × Trypsin-EDTA (Lonza, UK cat: T3924). Cell counts and viability were checked at the time of EV harvest using the trypan blue exclusion assay (0.4% Trypan blue solution ...
-
bioRxiv - Microbiology 2020Quote: ... Infected CD4 T cells were washed with PBS and 3 million cells per condition were resuspended in 20uL buffer P2 (Lonza) with 4μM IDT electroporation enhancer ...
-
bioRxiv - Immunology 2022Quote: ... Thawed PBMCS were rested for 3-4h at 37°C in X-VIVO 15 Serum-free Hematopoietic Cell Medium (Lonza) supplemented with 5% human Ab serum ...
-
bioRxiv - Neuroscience 2020Quote: ... The spinal cord was spun at 3000 rpm for 3 min at room temperature after which the embryonic medium was replaced with 1x trypsin-EDTA (Lonza). The tissue was macerated in trypsin and incubated at 37°C for 15-20 mins ...
-
bioRxiv - Microbiology 2021Quote: ... Viral supernatants were collected 3 and 6 days post-infection and induced-cell death and viral titers were determined in the ToxiLight Bioassay (Lonza) and PFA ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... 1×106 activated CD4+T cells were stimulated by IFN-γ for 24 h before being transfected with 3 siRNAs following Amaxa Nucleofector following the manufacturer’s protocols (Lonza). Two days post transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and diseased COPD human lung fibroblasts (DHLFs) from 3 donors (donor IDs: OF3353, OF3418 and OF3238) were purchased from Lonza and tested for their response to FGF2 and TGFβ stimulation.
-
bioRxiv - Cancer Biology 2022Quote: ... and then combined with 3 µL of RNP mixture and nucleofected using program DJ-110 (melanoma) or EH100 (TILs) on a 4D Nucleofector (Lonza). Melanoma cells were immediately recovered in full melanoma media in 12-well plates ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza, Basel, Switzerland) supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2023Quote: Ha deposition was detected staining constructs sections (n≥10 from n≥3 chambers considering two different hACs and two different MSCs donors) with OsteoImage (Lonza) as detailed above ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza, V4XP-3012) and the CA-137 program ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... 3 x 106 freshly isolated monocytes or BMDMs were resuspended in 20 µl of P3 primary cell nucleofection buffer (Lonza). Cells were then added to the Cas9-RNP complexes ...
-
bioRxiv - Cancer Biology 2024Quote: ... were annealed to Cas9 protein (IDT) and the ribonucleoprotein complex was transfected into SKOV-3 cells using a 4D-Nucleofector (Lonza). Bulk transfected cells were checked by flow cytometry for successful knock-down ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR products were then loaded and migrated by electrophoresis on a 3% Tris-borate-EDTA (TBE) agarose gel supplemented with GelStar Nucleic Acid Gel Stain (Lonza) for approximately one hour ...
-
bioRxiv - Physiology 2024Quote: ... counted and 3.106 cells resuspended in 100 μl Nucleofactor R solution and electroporated with 3 µg of plasmid (pcDNA3 containing or not α7-5HT3 cDNA) using the Amaxa nucleofactor kit R (Lonza) according to the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The constructs were then transfected into WT OSCs and Δl(3)mbt-OSCs with Nucleofector Kit V (Lonza, VVCA-1003) using T-029 program and a NucleofectorTM 2b Device (Lonza) ...
-
bioRxiv - Microbiology 2024Quote: ... P.berghei schizonts were electroporated with 3 mg of each plasmid using the FI115 program on the Amaxa Nucleofector 4D (Lonza). Transfected parasites were promptly injected intravenously into BALB/c mice and were subjected to selection with 0.07 mg/mL of pyrimethamine in drinking water starting from day one post-infection ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3×106 live cells were resuspended with the RNP complex and 20 µL of P3 Primary Cell Nucleofector Solution (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... HPAEC cells were procured from Lonza (catalog # CC-2530) and cultured in Endothelial Basal Media-2 (Lonza catalog #: CC-3516) supplemented with endothelial growth factors optimized for aortic and pulmonary arterial endothelial cells (Lonza catalog # CC-3162) ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells (2 × 105) were resuspended with SF buffer (V4XC-2032, Lonza, Basel, Switzerland) and pulsed with purified SpyCas9 (20 pmol).