Labshake search
Citations for Lonza :
751 - 800 of 2027 citations for 4 Bromo 3' 1 3 dioxolan 2 yl 2 fluorobenzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... hMBs were maintained in Skeletal Muscle Growth Media-2 (CC-3245; Lonza) as a growth medium (GM ...
-
bioRxiv - Microbiology 2023Quote: ... Corneal epithelial cells (hTCEpi) (54) were maintained in KGM-2 media (Lonza) lacking gentamicin ...
-
bioRxiv - Molecular Biology 2023Quote: Transfection experiments were performed using Amaxa Basic Parasite Nucleofector Kit 2 (LONZA). All transfectants were selected by treating mice with 70 μg/mL pyrimethamine ...
-
bioRxiv - Cell Biology 2023Quote: ... with EGM-2 SingleQuots supplement kit (CC-4176, Lonza Clonetics, Fisher scientific). All experiments were performed using low-passage cells (passage 3-8) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... all from EGM™-2 SingleQuots™ Supplement Pack (CC-4176, Lonza) abiding by manufacturer’s instructions as well as 10% (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... were maintained in EGM-2 endothelial cell growth medium (Lonza, Basel, Switzerland). Cells were passaged at 70 – 80% confluency ...
-
bioRxiv - Neuroscience 2024Quote: ... and transfected with 2 μg plasmid DNA using the 4D- Nucleofector (Lonza). The cells were recovered in RPMI-1640 medium (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: Transfection was performed using the Amaxa Basic Parasite Nucleofector Kit 2 (LONZA). All transfectants were selected by treatment of mice with 70 μg/mL pyrimethamine in their drinking water ...
-
bioRxiv - Developmental Biology 2024Quote: ... Pieces were mounted in 3.5 mm dishes in 2% agarose (Lonza, 50180) diluted in milliQ water (FunGI protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... HBMEC were transfected with lentivirus or siRNA in EGM-2 media (Lonza). HeLa (ATCC CCL-2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... For HUVEC cells EGM-2 endothelial cell growth medium (Lonza, CC-3162) was used and cells were kept under the same conditions as mentioned before ...
-
bioRxiv - Bioengineering 2024Quote: ... except that HUVECs were cultured in EC-growth medium (EBM-2, LONZA). EC-growth medium was supplemented with Single quots (EGM-2 ...
-
bioRxiv - Bioengineering 2024Quote: ... were maintained in endothelial cell growth medium (EGM™-2 BulletKit, Lonza) at 37 °C with 5% CO2 and used at passages 2 - 8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the generated constructs were immersed in Endothelial Growth Medium 2 (EGM2, Lonza) and cultured under submerged conditions in a controlled incubator environment for up to 5 days ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with EGM-2 MV SingleQuot Kit Supplements and Growth Factors (Lonza); 7 ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with EGM-2 MV SingleQuot Kit Supplements and Growth Factors (Lonza) at 37L°C with 5% CO2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... were purchased from Lonza Bioscience and were cultured in Endothelial Growth Medium-2 (cc-3162, Lonza) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µL of the sgRNA (total 300 pmol) was added to 12 µL of SE buffer (Lonza V4XC-1032). In another well ...
-
bioRxiv - Biochemistry 2021Quote: ... For each nucleofection 3 x 106 cells were resuspended in 80 μl of mouse ES cell nucleofection solution (Lonza). Equimolar (0.32 nmol ...
-
bioRxiv - Cancer Biology 2020Quote: ... were used in passages 3-6 and cultured on 0.1% gelatin-coated tissue culture plates in complete EGM2 (Lonza) supplemented to a total of 10% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Bioengineering 2024Quote: ... and SK-BR-3 cells (Korean Cell Line Bank, Korea) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Lonza, Switzerland) supplemented with 10 % (v/v ...
-
bioRxiv - Cell Biology 2022Quote: Normal human bronchial epithelial cells (HBECs) from 3 independent donors (Supplemental Table S1) were obtained from Lonza (CC-2540) and cultured in BEGM growth media (Lonza CC-3170) ...
-
bioRxiv - Biophysics 2023Quote: ... DNA samples were also analyzed by electrophoresis through 1.5 % and 3 % agarose gels (Seakem LE agarose, Lonza, Rockland, ME) in TAE (Tris-acetate + 1 mM EDTA ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: A total of 3-4µg of plasmid DNA was electroporated into 3-4x106 early passage ES cells using the Amaxa Nucleofector II (Lonza) programme A-023 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Genetics 2024Quote: ... Approximately 2.5×105 CD34+ HSPCs were mixed with gRNA:Cas9 complexes and 3 µg ssDNA donor template (20 μL) in nucleofector strip format (Lonza). Electroporation was performed in Unit X ...
-
bioRxiv - Cell Biology 2024Quote: ... NHEKs (no later than passage 3) were cultured in KGM Gold Keratinocyte Growth Medium BulletKit (00192060, Lonza, Basel, Switzerland). For daily maintenance and subculturing of NHEKs ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with the Endothelial Growth Medium (EGM-2) bullet kit (CC-3162, Lonza) and 1x antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were cultured in Endothelial Cell Growth Medium-2 BulletKit (CC-3162, Lonza) with 100 U/ml Penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were supplemented with EGM−-2 endothelial cell growth medium (Lonza, Basel, Switzerland). Cells were passage at 70 – 80 % confluency ...
-
bioRxiv - Bioengineering 2020Quote: ... were cultured with the Endothelial Cell Growth Medium-2 BulletKit (Lonza CC-3162) All cultures were maintained at 37°C ...
-
bioRxiv - Bioengineering 2020Quote: ... These cells were cultured and maintained in EGM-2 Bulletkit (CC-3162, Lonza). KLF2-GFP reporter cells were cultured M199 medium (12117F ...
-
bioRxiv - Cell Biology 2021Quote: ... Undifferentiated myoblasts were maintained in Skeletal Muscle Growth Media-2 (CC-3245; Lonza). 7.5 × 104 myoblasts were seeded on 30-mm dishes for immunocytochemistry ...
-
bioRxiv - Bioengineering 2021Quote: ... were grown in Fibroblast Growth Medium (FGM-2 BulletKit™, CC-3132, Lonza). Cells were cultured under a humidified incubator at 37°C and 5% CO2 and grown up to 80% confluency for experiments ...
-
bioRxiv - Microbiology 2020Quote: ... pre-warmed DMEM with 2 % FBS mixed with liquid SeaPlaque™ Agarose (Lonza) to a final concentration of 0.8 % agarose was added to cells two hours post infection ...
-
bioRxiv - Immunology 2020Quote: ... PBMCs were expanded for 2 weeks in X-vivo media (Lonza, BE02-060Q) supplemented with 5% human serum (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sorted cells were cultured in Endothelial Growth Media (EGM-2) (Lonza, Basel, Switzerland) on 2% gelatin-coated chamber slides ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 mM L-Glutamine and 100 U/ml Pen-Strep (all from Lonza). Cell lines were regularly tested for mycoplasma contamination ...
-
bioRxiv - Bioengineering 2022Quote: ... were obtained from Lonza (CC-2576) and cultured using SmGM™-2 BulletKit™ (Lonza CC-3182). All cells were from patients ranging in age from 30 to 65 years old and were sub-cultured according to Lonza’s recommended protocol.
-
bioRxiv - Biochemistry 2022Quote: ... grown to 1.6-2 million cells/ml in Insect-XPRESS media (Lonza™), were infected with P1 viral stocks at 16 ml/L ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with the Endothelial Growth Medium (EGM-2) bullet kit (CC-3162, Lonza) and 1x antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... HSC-2 (JCRB0622) cells were cultured in EMEM (Eagle’s Minimum Essential Medium; Lonza), while HO-1-N-1 (JCRB0831 ...
-
bioRxiv - Immunology 2020Quote: RAW264.7 and 293 TLR4/CD14/MD-2 cells were cultured in DMEM (Lonza) supplemented with 10 % FBS (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were collected after two days in SKGM (SKGM-2, Lonza CC-3245) culture ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with Endothelial Cell Growth Medium (EGM)-2 Bullet Kit (CC-3162; Lonza)) ...
-
bioRxiv - Cell Biology 2021Quote: ... The hMBs were maintained in Skeletal Muscle Growth Media-2 (CC-3245; Lonza) as a growth medium for hMBs (hMB-GM) ...
-
bioRxiv - Cancer Biology 2021Quote: ... were obtained from Lonza and were cultured in EGM-2 SingleQuot Kit media (Lonza, cat #CC-3162) and used at passage 2-10 ...
-
bioRxiv - Bioengineering 2022Quote: ... that was supplemented with EGM™-2 SingleQuots™ supplements (LONZA, CC-4176), 10 % FCS and 1 % P/S ...
-
bioRxiv - Molecular Biology 2022Quote: ... HAECs were cultured in EBM-2 supplemented with singleQuots (LONZA, Clonetics CC-4176) and Endothelial Cell Growth Kit-VEGF (ATCC ...