Labshake search
Citations for Lonza :
801 - 850 of 9698 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The ToxiLight™ Non-Destructive Cytotoxicity BioAssay (Lonza, #186467,) was used to measure adenylate kinase release in vaginal lavage fluid as a measure of tissue damage per the manufacturer’s instructions ...
-
Antibodies targeting Crimean-Congo hemorrhagic fever virus GP38 limit vascular leak and viral spreadbioRxiv - Microbiology 2024Quote: ... All endothelial cells were cultured in endothelial cell growth basal medium 2 supplemented with an Endothelial Cell Growth Medium-2 (EGM-2) microvascular cells supplemental bullet kit (Lonza) and maintained at 37 °C with 5% CO2.
-
bioRxiv - Microbiology 2024Quote: ... aspirate supernatant and cover the cell monolayer with 3ml per well of 1.5% Sekam ME Agarose (Lonza; Cat. No. 50011), 2X EMEM (quality Biological ...
-
bioRxiv - Molecular Biology 2024Quote: ... Dharmacon #L-089810-02-0005) using AmaxaTM Basic NucleofectorTM kit (#VPI-1006, Lonza) for Primary Mammalian Glial cells following the manufactureŕs instructions.
-
bioRxiv - Microbiology 2024Quote: ... One million cells resuspended in 100 μL of SF Cell Line Nucleofector solution (Lonza V4XC-2012) were electroporated with 2 μg plasmid using pulse code FF-120 (Lonza Amaxa 4D Nucleofector) ...
-
bioRxiv - Microbiology 2024Quote: ... were electroporated with 2 μg plasmid using pulse code FF-120 (Lonza Amaxa 4D Nucleofector). Cells were incubated for 10 minutes at room temperatue ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Pen/Strep amphotericin B (Lonza). Cells were harvested by centrifugation at 700 x g ...
-
bioRxiv - Microbiology 2024Quote: ... and treated before coculture if necessary (PlasmocureTM, Lonza). Cells were cocultured with dispersed bacteria from biofilms (normalized optical density ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were screened for mycoplasma infection (MycoAlertTM, Lonza, Bâle, Switzerland) and treated before coculture if necessary (PlasmocureTM ...
-
bioRxiv - Microbiology 2024Quote: ... using pulse code FF-120 (Amaxa 4D Nucleofector, Lonza). Cells were incubated for 10 minutes at room temperature following nucleofection ...
-
bioRxiv - Microbiology 2024Quote: ... and 18 μL of SF Cell Line Nucleofector solution (Lonza V4XC-2032). Complexes were mixed and incubated for 10 min at room temperature prior to addition to 5 μL of cells (1e5 for U937 ...
-
bioRxiv - Microbiology 2024Quote: ... round floating HPCs were harvested and cultured for up to three more days in X-vivo-15 basal media (Lonza, Switzerland), supplemented with 100 ng/mL M-CSF (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... Mature schizonts were purified by a Nycodenz gradient and transfected with the recombination construct using the Amaxa electroporation system (Lonza). Transfected merozoites were injected into the tail vein of a BALB/c mouse (6–8 weeks of age ...
-
bioRxiv - Microbiology 2024Quote: One million K562 cells were electroporated with 3 μg of DENV2-luciferase replicon [38] (provided by Jan Carette, Stanford University) in 100 μL SF Cell Line Nucleofector solution (Lonza V4XC-2012) using pulse code FF-120 (Amaxa 4D Nucleofector ...
-
bioRxiv - Microbiology 2024Quote: ... This mixture was transferred to a 16-well nucleocuvette for nucleofection with an Amaxa 4D Nucleofector (Lonza) according to manufacturer’s protocol using pulse code FF-120 for K562 cells or EP-100 for U937 cells ...
-
bioRxiv - Microbiology 2024Quote: ... All cells were maintained in a humidified incubator with 5% CO2 at 37°C and tested negative for mycoplasma by MycoAlert (Lonza, Morristown, NJ).
-
bioRxiv - Neuroscience 2024Quote: ... Presence of mycoplasma in culture was assessed using the MicoAlert assay control test according to the manufacturer’s instructions (cat #LT07-518, Lonza). Sanger sequencing was performed to verify the presence of pathogenic variant in patient cell lines (clones 11 and 13 ...
-
bioRxiv - Neuroscience 2024Quote: ... All the iPSC lines were tested negative for mycoplasma regularly (Lonza, LT07-418). iPSCs were maintained on Matrigel (Corning ...
-
bioRxiv - Bioengineering 2024Quote: ... normal human lung FBs (CC-2512; Lonza); and MDA-MB-231 triple-negative breast cancer cells (CRM-HTB-26 ...
-
bioRxiv - Microbiology 2024Quote: ... The linearized plasmid was transfected into Jurkat T cells using the AMAXA Nucleofector (Lonza, Switzerland), with strict adherence to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼300 pairs of ovaries were dissected from 3-6 day old females in 1× PBS (Lonza) with 1 mM DTT (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... Deletion of 4 nucleotides was then directly checked on 4% low melting MetaPhor® agarose gel (Lonza) and in some cases verified by sequencing.
-
bioRxiv - Molecular Biology 2024Quote: ... Suspension of 2.5 × 105 PGCs in Nucleofector Solution V (Lonza) was mixed with 10 μg of pX458-tetherin in total volume of 100 μL and nucleofection was performed with the AMAXA nucleofector (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... was mixed with 10 μg of pX458-tetherin in total volume of 100 μL and nucleofection was performed with the AMAXA nucleofector (Lonza) using the A-27 program ...
-
bioRxiv - Cell Biology 2024Quote: ... were obtained from Stephen Elledge’s laboratory at Harvard Medical School73 and cultured in MEGM™ Mammary Epithelial Cell Growth Medium (Lonza CC- 3150). In microscopy experiments we used the same media but without phenol red to reduce background fluorescence (Lonza CC-3153 phenol-red free basal media supplemented with growth factors and other components from the Lonza CC4136 kit) ...
-
bioRxiv - Immunology 2024Quote: ... digestion for 45 min at 37 °C and then treated with ACK buffer (Lonza) to remove red blood cells ...
-
bioRxiv - Immunology 2024Quote: ... cells were transfected by nucleofection (Amaxa Nucleofactor, Lonza VCA-1003) with 5 μg DNA for 5 million of cells using the C-016 program ...
-
bioRxiv - Immunology 2024Quote: ... were cultured in RPMI 1640 medium (Lonza) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2024Quote: ... Red blood cells were lysed using ammonium-chloride-potassium (ACK) lysis buffer (Lonza).
-
bioRxiv - Immunology 2024Quote: ... lung epithelial cells from FACS (as described above) were resuspended in SAGM (Lonza) mixed 1:1 with growth-factor reduced Matrigel (BD Biosciences ...
-
bioRxiv - Immunology 2024Quote: ... and HEPES (1M, Lonza)) was followed by transfer to 10 ml of digestion solution (containing RPMI ...
-
bioRxiv - Immunology 2024Quote: Blood samples were collected via cardiac puncture under terminal anaesthesia and were placed directly into in EDTA (Lonza). Red blood cells were lysed using ammonium-chloride-potassium (ACK ...
-
bioRxiv - Immunology 2024Quote: ... insert and placed in one well of a six-well plate in 1 ml serum free culture medium (“RB27”) composed of RPMI 1640 (Lonza), 4% B27 supplement (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... Basal medium was Power-CHO-2 (Lonza, Basel, Switzerland) supplemented with 8 mM Glutamine (Cultek ...
-
bioRxiv - Immunology 2024Quote: ... and 1% Pen-Strep (DE17-602E; Lonza). Dynabeads Human T-Activator CD3/CD28 (11161D ...
-
bioRxiv - Immunology 2024Quote: ... All cell lines were screened biweekly for mycoplasma contamination using MycoAlert mycoplasma detection kit (Lonza). Melanoma and JY cells were subjected to cell line typing (Microsynth Ecogenics ...
-
bioRxiv - Immunology 2024Quote: ... Electroporation was performed according to the Human T cell nucleofactor kit protocol (Lonza) as previously described2 ...
-
bioRxiv - Immunology 2024Quote: ... HUVEC cells were grown in EGM Plus media supplemented with EGM Plus SingleQuots (Lonza).
-
bioRxiv - Biochemistry 2024Quote: ... 3×105 cells were electroporated using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza) with 400 ng donor DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nucleofection were performed using Amaxa P3 Primary Cell kit (Lonza, V4XP-3024) and 4D-transfector ...
-
bioRxiv - Immunology 2024Quote: ... then red blood cells were lysed using ACK lysis buffer (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... media supplemented with EGM-2 SingleQuots Supplements (Lonza CC-4176) until 80% confluent ...
-
bioRxiv - Cell Biology 2024Quote: Human umbilical vein endothelial cells (HUVECs) were cultured in EBM-2 (Lonza CC-3156) media supplemented with EGM-2 SingleQuots Supplements (Lonza CC-4176 ...
-
bioRxiv - Cell Biology 2024Quote: Human Umbilical Vein Endothelial Cells (HUVECs, Lonza Scientific) and Bovine Aortic Endothelial Cells (BAECs ...
-
bioRxiv - Immunology 2024Quote: ... and the GFPSpark and mCherry control vectors (DNA/cell ratio = 1.5 µg/106 cells in single transfections and 1.2 µg/106 cells in co-transfections) by using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 ...
-
bioRxiv - Immunology 2024Quote: For RNAi-mediated TSP-1 and TSP-4 silencing 4×106 3-day activated CD8+ T cells were transfected using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 with 150 pmol/106 cells of human TSP-1 and TSP-4-specific siRNAs (#s14108 and #s14100 ...
-
bioRxiv - Immunology 2024Quote: ... 8×106 CTLs were transfected with 6 µg of plasmid DNA of each construct with P3 Primary Cell 4D-Nucleofector X Kit (Lonza). For the CLEM experiments the cells were transfected with TSP-1-GFPSpark and TSP-4-mCherry ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 10% (v/v) fetal bovine serum (FBS; Biowest, S181B) and 0.2% (v/v) MycoZap (Lonza, VZA-2012) in a humidified atmosphere of 5% CO2 at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 12ug/ml Bovine Brain Extract (Lonza CC-4098), 10ng/ml hEGF (Sigma E9644) ...