Labshake search
Citations for Lonza :
651 - 700 of 763 citations for Recombinant HBV X Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... 2×105 cells were co-transfected with 2ug of the Cas9/sgRNA vector PxHF1* and 4 ul of ssODN HDR template (20 uM) using a Lonza X-Unit Nucleofector with P3 buffer kit (Lonza #V4XP-3032). Four days following transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and the GFP-K17ΔNLS (Hobbs et al., 2015) were nucleofected into HeLa cells using SE Cell Line 4D X nucleofector Kit S (Lonza #V4XC-1032) with setting DS-138 ...
-
bioRxiv - Microbiology 2021Quote: ... were isolated by Ficoll density gradient centrifugation as described previously [22] and seeded at a density of 1×106 cells/cm2 in X-VIVO 15 medium (Lonza, Cologne, Germany) supplemented with 10% (v/v ...
-
bioRxiv - Immunology 2020Quote: ... 2 million L1.2 cells were transfected with 2 µg of plasmid using the SG Cell Line transfection kit and a 4D-Nucleofector X (both from Lonza, Walkersville, MD) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... mESCs in 6-cm dishes were transfected with 7.2 μg pX330-Cas9 plus 1.8 μg GFP expression vector by 4D-nucleofector X (Lonza, solution Cytomix, program GC104), then harvested for genomic DNA 3 days after transfection.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... UCB-MNC were thawed and cultured at 2 million cells/mL in X-VIVO 15 serum-free cell-culture medium (Lonza, Basel, Switzerland) supplemented with 0.5 μg/mL of FMS-like tyrosine kinase-3 and 0.5 μg/mL of stem-cell factor ...
-
bioRxiv - Neuroscience 2020Quote: ... dissociated ganglia were pelleted at 100 x g for 5 min and resuspended in 100 µl ‘Nucleofector solution’ (Rat Neuron Nucleofector kit; Lonza, Alpharetta, GA). 4-6 μg of plasmid was electroporated using the AMAXA Nucleofector device (Neurons Rat DRG ...
-
bioRxiv - Developmental Biology 2022Quote: ... The plasmids were co-transfected into H9 hESC cells using the Amaxa 4D nucleofector (#AAF-1003B and #AAF-1003X) and the P3 Primary Cell 4D-Nucleofector X kit (Lonza, #V4XP-3024).
-
bioRxiv - Cancer Biology 2023Quote: ... 20uL of which was subsequently transferred to 16-well Nucleocuvette Strip and electroporated using the 4D-Nuceleofector X unit (program FF120, Lonza, AAF-1002X). Warmed culture medium (100uL ...
-
bioRxiv - Developmental Biology 2023Quote: ... ePB master vector and helper (Plasmid AW-27) were nucleofected into the established SOX2::mCitrine cell line using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012). G-418 (40ng/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Genomics 2023Quote: ... was mixed with 16.4 μL Nucleofector SolutionTM and 3.6 μL Supplement and incubated at room temperature for about 10 min according to the instruction of Amaxa 4D-Nucleofector X Kit TM (Lonza, #V4XP-3032). HepG2 ...
-
bioRxiv - Immunology 2023Quote: ... Purified templates together with 2 µg of LentiGuide-Gbp-Chr3-sg3+sg4 were electroporated into RAW-Cas9 cells using Lonza SF cell line X kit (Lonza, V4XC-2012) on a Lonza 4D-Nucleofector unit (Lonza) ...
-
bioRxiv - Cell Biology 2023Quote: ... TC28a2 reporter lines were generated using an identical manner to HEK293T except DNA was introduced using electroporation using the X-001 program on the Nucleofector 2b (Lonza, AAB-1001) in combination with Nucleofector Kit V (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: CD34+ cells collected from each animal on the two days of apheresis were placed in culture for 48 hours in X-VIVOTM 10 (Lonza, Walkersville, MD) supplemented with 1% human serum albumin (HSA ...
-
bioRxiv - Cell Biology 2024Quote: ... monocytes were cultured in 24-well plates (Labclinics, Barcelona, Spain) at a concentration of 106 cells/ml in either X-VIVO 15 media (Lonza, Basel, Switzerland) or RPMI 1640 media (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... Each plasmid library was transfected into K562 or A549 cells by electroporation using Lonza SF Cell Line 4D-Nucleofector X Kit (Lonza V4XC-2012) with Lonza 4D-Nucleofector ...
-
bioRxiv - Molecular Biology 2023Quote: ... were mixed with 1.49 µL of ssODN (100 µM) and Cas9 complex consisting of 18 µL SF 4D-nucleofector X solution + supplement1 (Lonza V4XC-2012), 6 µL of sgRNA (30 pmol/µL) ...
-
The spindle protein CKAP2 regulates microtubule dynamics and ensures faithful chromosome segregationbioRxiv - Cell Biology 2023Quote: ... and immediately transfected by Nucleofection into HT-1080 cells using the Amaxa SF Cell Line 4D-Nucleofector X kit S (Lonza, PBC2-00675) and either program FF-113 (HT1080 ...
-
bioRxiv - Bioengineering 2023Quote: ... 100,000 cells were resuspended in 20μl P3 reagent of the P3 Primary Cell 4D-Nucleofector® X Kit S (Lonza V4XP-3032). 1 μg total plasmid was used for a single nucleofection event and nucleofected by program EH-100 ...
-
bioRxiv - Immunology 2023Quote: ... Constructs were transiently transfected into KRT17 null A431 cells using the SF Cell Line 4D-Nucleofector™ X Kit (Lonza #V4XC-2032) and Lonza 4D-nucleofector X unit “A431 cell” program ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1.5 x 106 cells were transfected with 1 µg DNA (500 ng Cas9 plasmid and 500 ng linearized donor plasmid) by nucleofection (pulse code CA137) using P3 Primary Cell 4D-Nucleofector X kit (Lonza, V4XP-3024) in a 4D-Nucleofector (Lonza ...
-
bioRxiv - Immunology 2023Quote: ... T cells were then rinsed with PBS and 10 × 106 cells were resuspended in 20 µl of P4 primary cell nucleofection solution (P4 Primary Cell 4D-Nucleofector X Kit S, Lonza V4XP-4032). 20 μL of resuspended T cells were then gently mixed with 5 µL of RNP complex and incubated for 2 minutes at room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... RNP’s and DNA were electroporated (EP) into T-cells in 16 well EP cuvettes on a 4-D Nucleofector X unit (Cat # V4XP-3032, Lonza, Walkersville, VA) using pulse code EH-115 ...
-
bioRxiv - Cell Biology 2024Quote: ... EBs are transferred to a 6-well plate with 20 EBs/well and placed in macrophage precursor medium (X-vivo15 (Lonza, BE02-060Q), 100 ng/mL M-CSF (Peprotech ...
-
bioRxiv - Synthetic Biology 2024Quote: Electroporation was done 7 days after stimulation by DynaBeads using a P3 Primary Cell 4D-Nucleofector™ X Kit (Lonza #V4XP-3012). 750 ng of HDR template was mixed with 50 pmol of RNP and incubated at room temperature for 10 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... CRISPR-CAS9 knockout in SU-DIPGXIII cells was performed using the Amaxa P3 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-3012). First ...
-
bioRxiv - Cell Biology 2024Quote: The NK-92 cell line was acquired from the American Type Culture Collection and cultured in X-VIVO 10 (Lonza, 04-380Q) supplemented with 20% fetal bovine serum (FBS ...
-
bioRxiv - Genomics 2024Quote: ... were complexed for 20 minutes at room temperature and were nucleofected into 5E5 PEmax parental cells using the SE Cell Line 4D-Nucleofector X Kit (Lonza V4XC-1032) and program FF-120 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were resuspended in 20 µl nucleofection buffer (16.4 µl Nucleofector® Solution + 3.6 µl Supplement) provided in P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza, V4XP-3032). After the addition of 3 µl RNP and 0.5 µl of Alt-R Cas9 Electroporation Enhancer (IDT ...
-
bioRxiv - Microbiology 2024Quote: ... 5 million parasites were electroporated with 5-10ug of digested plasmid with an AMAXA Nucleofector II using X-001 in Human T-cell Nucleofector Solution (Lonza VPA-1002).
-
bioRxiv - Immunology 2020Quote: ... both grown in Insect-XPRESS Protein-free Insect Cell Medium (Lonza, BE12-730Q) supplemented with L-glutamine (to 1%) ...
-
bioRxiv - Genomics 2020Quote: ... 2*106 TX1072 mESCs were electroporated with 2µg of each guide plasmid and 30pmol of the single stranded repair oligo using the P3 Primary Cell 4D-Nucleofector X Kit (V4XP-3024) with the Amaxa 4D Nucleofector system (Lonza, program CP-106) and plated on gelatin-coated 10cm dishes ...
-
bioRxiv - Neuroscience 2019Quote: A human neuroglioma H4 cell-derived cell line stably over-expressing αSyn from a tetracycline inducible promoter20 was grown in serum-free X-VIVO media (Lonza Group, Basel, Switzerland). Cells were seeded in 96-well plates at 100K cells per well ...
-
bioRxiv - Cell Biology 2021Quote: ... The solution was transferred into a certified cuvette and cell electroporation was conducted using Nucleofector® program X-013 (Amaxa® Nucleofector®, Lonza). Electroporated cells were immediately resuspended in pre-warmed phenol-free Leibovitz’s-L-15 medium (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Neuroscience 2022Quote: ... and pCXLE-hUL (#27080) were transfected into fibroblasts using a 4D-Nucleofector system with P2 Primary Cell 4D-Nucleofector X Kit (Lonza; program DT-130). Three to five weeks after reprogramming ...
-
bioRxiv - Immunology 2022Quote: ... The Cas9 protein and sgRNA were electroporated into the T cells by using Amaxa 4D-Nucleofector System and P4 Primary Cell 4D-Nucleofector® X Kit S (Lonza, V4XP-4032) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Conditioned media (containing EVs) was removed and the cells washed x 2 with PBS before trypsinisation using 1 × Trypsin-EDTA (Lonza, UK cat: T3924). Cell counts and viability were checked at the time of EV harvest using the trypan blue exclusion assay (0.4% Trypan blue solution ...
-
bioRxiv - Immunology 2020Quote: ... Human buffy coats were initially added to 40 ml chemical-defined serum-free culture X-VIVO 15™ mediums (Lonza, Walkersville, MD, USA) and mixed thoroughly with 10ml pipette ...
-
bioRxiv - Immunology 2021Quote: ... CRISPR knockout was done by application of RNP complexes with the 4D Nucleofector™ device (4D-Nucleofector™ Core Unit; 4D-Nucleofector™ X Unit, both Lonza) using the P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza ...
-
bioRxiv - Genomics 2021Quote: ... Growing CH12F3 cells were transfected with 1.5 μg pX330-Cas9 or pX330-Cas9-mCherry expression vector per million by 4D-nucleofector X (Lonza, solution M1, procedure DN100) and seeding at 0.5 million cells/mL in fresh medium with 1μg/mL anti-CD40 ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested EBs were transferred to a tissue-culture treated 6-well plate (Falcon, #353224) in 3 ml of EB Differentiation media: X-VIVO 15 (Lonza Biosciences, #04-418Q) + 1% Glutamax (Life Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... the cells were then additionally nucleofected with ribonuclease complex of ITGB2 sgRNA and Cas9 using P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza, V4XP-3032) using 4D-Nucleofector (Lonza ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cells are spun at 1250 x g for 5 minutes and resuspended in 25 µl Lonza SF buffer (Lonza Cat. No. V4SC-2960) if cycloheximide selection will not be used or 200 µl of SF buffer if cycloheximide selection will be used.
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of 1E6 cells were resuspended with 20ul supplemented nucleofector solution of the P3 Primary Cell 4D-nucleofector® X Kit S (Lonza, V4XP-3032) and 2ug plasmid (1ug/ul) ...
-
bioRxiv - Neuroscience 2023Quote: ... into control and disease related iPSC lines in Amaxa® 4D- Nucleofector® using P4 Primary Cell 4D-Nucleofector® X Kit (Lonza) with the CM133 program ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were nucleofected using program DS137 and buffer P3 on the 4D- Nucleofector system (4D-Nucleofector X unit, Lonza, cat. no. AAF-1003X). Pre-warmed complete culture medium supplemented with IL-7 (10ng/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... Next 1 × 106 cells resuspended in 93 μL of P3 Primary Cell Nucleofector Solution (P3 Primary Cell 4D-Nucleofector X Kit, Lonza, Catalog #: V4XP-3024) were mixed with 7 μL of RNP and 12 μg of single-stranded oligodeoxynucleotide (ssODN ...
-
bioRxiv - Cancer Biology 2023Quote: Electroporation of multiplex CRISPR-Cas9 pX330 plasmids into normal bronchial epithelial cells was achieved using the P3 Primary Cell 4D-Nucleofector® X Kit L (Lonza, V4XP-3024) and 4D-Nucleofector™ X Unit (Lonza) ...