Labshake search
Citations for Lonza :
551 - 600 of 763 citations for Recombinant HBV X Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... neurons were transfected by electroporation before seeding with target siRNA or ntRNA using a 4D-Nucleofector X Unit and the corresponding P3 Primary Cell nucleofection kit (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... transfection was performed with 3.5 μg of PF16eYFPNeo introduced into 108 cells using a Human T-cell kit and IIb Nucleofector set to program X-001 (Lonza). Other transfections described in this work used the same conditions except with Tb-BSF buffer (90 mM sodium phosphate ...
-
bioRxiv - Immunology 2022Quote: ... containing RNP complex and enhancer DNA (IDT, Cat.1075915) and under electroporation with CM-137 program of 4D-nucleofactor X Unit (Lonza). Electroporated T cells recovered overnight in IL7 medium were then activated by anti-mouse CD3/CD28 beads (at 1:1 ratio for two days and expanded in culture medium containing 5ng/ml hIL2 ...
-
bioRxiv - Cell Biology 2022Quote: ... EBs were seeded at 100–150 EBs per T175 or 250–300 per T225 flask in factory medium consisting of X-Vivo 15 (Lonza) supplemented with Glutamax (Gibco) ...
-
bioRxiv - Immunology 2023Quote: ... isolated WT P14 CD8+ T cells were washed with PBS and mixed with RNPs by using P3 Primary Cell 4D-NucleofectorTM X Kit (Lonza) immediately prior to electroporation (Lonza 4D-nucleofactorTM core unit ...
-
bioRxiv - Neuroscience 2023Quote: ... 01F49i-N-B7 iPSCs were dissociated to single cells and 250,000 cells transfected with 25 μL of the prepared transfection mix containing 20 µL of nucleofection buffer (P3 Primary Cell 4D-NucleofectorTM X Kit S, Lonza), 5 µL of the RNP complex ...
-
bioRxiv - Immunology 2023Quote: CRISPR–Cas9 gene knockout was performed by transient Cas9/gRNA (RNP) complex electroporation using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). On day 4 of culture ...
-
bioRxiv - Immunology 2023Quote: ... were used to sort CD3-positive T cells from peripheral blood mononuclear cells (PBMCs) and T cells were cultured in X-vivo (Lonza) medium supplemented with 5% FBS (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... twice and resuspended in Cell Line Nucleofector solution SF (16.4uL) with Supplement (3.6uL) (SF Cell Line 4D-nucleofector X Kit, Lonza, V4XC-2032). Alt-R SpCas9 nuclease (100pmol ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in 90 µL of nucleofection solution (16.2 µL of Supplement solution mixed with 73.8 µL of SF solution from SF Cell Line 4D-Nucleofector™ X Kit L) (Lonza), transferred to the 15 µL RNP solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were resuspended in respective electroporation/nucleofection buffer (HEK293T cells and HepG2 SF Buffer (SF Cell Line 4D-Nucleofector X Kit, Lonza), Jurkat cells SE buffer (SE Cell Line 4D-Nucleofector X Kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 µl sterilised DNA was mixed with 5E6 cells submerged in 200 µl of 1.25x Tb-BSF buffer (final transfection volume 250 µl with 1x Tb-BSF buffer) and transfected using one pulse with program X-001 on an Amaxa Nucleofector IIb (Lonza). Cells were recovered in M199 culture medium as specified above and 8-16 hours post transfection the required selection drug was added ...
-
bioRxiv - Microbiology 2023Quote: ... transfections were performed by introducing DNA into ∼108 Percoll-enriched schizonts by electroporation using an Amaxa 4D Nucleofector X (Lonza), using program FP158 as previously described (Moon et al. ...
-
bioRxiv - Molecular Biology 2023Quote: Transfections of K562 cells were performed using a Lonza Bioscience 4D-Nucleofector system and the SF Cell Line 4D-Nucleofector X kits (Lonza). For single nucleocuvettes (100 uL) ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... were individually index sorted to each well of 96-well containing FL-AKT-EC in serum-free coculture media consisting of X-VIVO 20 (Lonza) with recombinant cytokines (PeproTech) ...
-
bioRxiv - Cancer Biology 2023Quote: ... were resuspended in 4D-Nucleofector Solution and then mixed with the Cas9/sgRNA complex and electroporated using the 4D-Nucleofector X Unit (Lonza). All tumor cell lines were maintained in high-glucose DMEM supplemented with 10% (v/v ...
-
bioRxiv - Genomics 2023Quote: ... Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit: Lonza, AAF-1002B; 4D-Nucleofector X Unit: AAF-1002X; Lonza). Programs were adapted for the different cell types (HCT116-Cas9 ...
-
bioRxiv - Immunology 2023Quote: ... at bead-to-cell ratio of 1:1 in human IL-2 medium (X-VIVO 15, serum-free hematopoietic cell medium, with 2mM L-Glutamine and gentamicin (Lonza) supplemented with 5% Human AB serum (Valley Medical) ...
-
bioRxiv - Immunology 2023Quote: ... cells were also mixed with 1.4- 2 µg of plasmid homology donors or 100 pmol phosphorothioate-modified ssODNs as previously described.59 Electroporations were performed with the 4D-X Nucleofector (Lonza). K562 cells used pulse code FF-120 ...
-
bioRxiv - Cancer Biology 2023Quote: Cas9-RNPs were transfected into cells by electroporation (SF Cell Line 4D-Nucleofector™ X Kit S (Lonza, #V4XC-2032)) ...
-
bioRxiv - Immunology 2022Quote: ... Cryopreserved PBMC (5 x 106/sample) were thawed in prewarmed RPMI-1640 media supplemented with L-glutamine (Lonza, Basel, Switzerland) + 10% FCS ...
-
bioRxiv - Bioengineering 2023Quote: Approximately 0.25 × 106 U2OS.eGFP-PEST cells were nucleofected with 300 ng of Cas9 expression plasmid and 30 ng of eGFP-targeting gRNA expression plasmid using the SE Cell line 4D-Nucleofector X Kit (Lonza) and DN100 pulse program ...
-
bioRxiv - Bioengineering 2023Quote: ... and 50 ng of AcrIIA4 expression or 300 ng of Cas9-P2A-CSD-AcrIIIA4 plasmid and 30 ng eGFP-targeting gRNA expression plasmid using the SE Cell line 4D-Nucleofector X Kit (Lonza) and DN100 pulse program ...
-
bioRxiv - Cell Biology 2023Quote: ... hESCs were nucleofected with RNPs using the 4D-Nucleofector and P3 Primary Cell 4D-Nucleofector X Kit and program CB150 (Lonza). After 24□hours ...
-
bioRxiv - Cell Biology 2023Quote: ... Five million BJAB or OCI-LY1 cells were transfected with 2 μg plasmid DNA using the SF Cell Line 4D-Nucleofector X Kit L (Lonza) and the AMAXA Nucleofector biosystem (BJAB ...
-
bioRxiv - Developmental Biology 2023Quote: ... and co-transfected with an ssODN donor template containing the desired modification into H9/WA09 cells via nucleofection (Amaxa P3 primary cell 4D nucleofector X kit L, Lonza) using the manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2023Quote: ... 2.5e5 RPE1 CRISPRi cells were nucleofected with 3μM RNP complex using an SE Cell Line 4D X Kit S (Lonza Bioscience) on a 4D-Nucleofector (Lonza Bioscience ...
-
bioRxiv - Neuroscience 2023Quote: ... before being introduced to the KOLF2 hiPSCs through electroporation (P3 Primary Cell 4D-Nucleofector X Kit, Program CA-137, Lonza). The resulting clones were screened by multiplexed amplicon sequencing on an Illumina Mi-Seq platform with the MiSeq Reagent Kit V2 (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... All this volume was transferred to an electrolytic cuvette and transfection was performed using the X-001 program of Amaxa Nucleofector instrument (LONZA). The culture was maintained in M199 at 26°C before selection with the appropriate drugs (16μg/mL hygromycin-B ...
-
bioRxiv - Neuroscience 2023Quote: ... The cell pellet was used for nucleofection using the P3 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-3024), a 4D-nucleofector core unit and X unit (Lonza ...
-
bioRxiv - Immunology 2023Quote: ... and cultured in 96-well culture plates (2×103 cells/well) with serum or EP-stimulated MDMs supernatants in X-VIVO 15 medium (Lonza) with 10 U/mL of IL-2 (PeproTech ...
-
bioRxiv - Molecular Biology 2023Quote: ... Parasites were then subjected to one pulse using X-001 program in the Amaxa Nucleofector 2b (Lonza Cologne AG, Germany). Transfected cells were cloned after 6 h in 24-well dishes with the appropriate selective drugs (2.5 μg/ml of G-418 ...
-
bioRxiv - Cell Biology 2023Quote: ... JAWS transfection was achieved using 20 μg DNA and 2 x 106 million cells per 100 μl nucleofection solution from the Amaxa Nucleofector Mouse Dendritic Cell kit (Lonza), and the Y-001 program ...
-
bioRxiv - Cell Biology 2023Quote: Pooled knockout cell lines were generated by electroporating Cas9-guide RNA ribonucleoprotein complexes into reporter K562 cells using an Amaxa 4D Nucleofector X Unit (Lonza) and the SF Cell Line 4D-Nucleofector X Kit S (Lonza) ...
-
bioRxiv - Cell Biology 2023Quote: ... EBs were transferred to T175cm2 flasks for macrophage differentiation using factory media consisting of X-VIVO 15 (LZBE02-061Q, Lonza), 2 mM Glutamax (35050061 ...
-
bioRxiv - Molecular Biology 2023Quote: ... spanning the whole SARS-CoV-2 genome was transfected into 2×106 HEK293T cells using the SF Cell Line 4D-Nucleofector-X Kit (Cat# V4XC-2012, Lonza) and the 4D-Nucleofector X Unit (Lonza ...
-
bioRxiv - Genomics 2024Quote: Transfections of DNA constructs in ESCs were performed using the P3 Primary Cell 4D-Nucleofector X Kit (V4XP-3024) and the Amaxa 4D Nucleofector system (Lonza). For each nucleofection ...
-
bioRxiv - Immunology 2024Quote: Ten micrograms of expression plasmid or 20 pmol of siRNA were introduced into 1 x 107 BMDC cells by electroporation using a Nucleofector 2b (Lonza) with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza) ...
-
bioRxiv - Cell Biology 2023Quote: ... nucleofected in a 100 µl reaction using the Lonza 4D-Nucleofector System with P3 Primary Cell 4D-Nucleofector X Kit (Lonza) and program CA137 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... negative selection of T cells was performed using the EasySep human T cell isolation kit (Stemcell) and cultured in X-VIVO 15 medium (Lonza) supplemented with 5% fetal bovine serum (FBS) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 x 105 to 1 x 106 cells were resuspended in 20µL of nucleofection solution (P3 Primary Cell 4D-Nucleofector™; Lonza) and nucleofected (Lonza 4D nucleofector TM Core + X Unit ...
-
bioRxiv - Immunology 2023Quote: ... The transfection was carried out by nucleofection using Amaxa® Cell Line Nucleofector Kit V (Program X-001, Lonza, USA). At 24 h after transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected with RNP complex and HDR templates by nucleofection with SF Cell Line 4D-Nucleofector X Kit (Lonza) using 20-ml Nucleocuvette Strips ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 2 mm BTX cuvettes (Tb-BSF transfection) with one pulse of the X-001 program on an Amaxa Nucleofector 2b (Lonza). For measuring transfection efficiencies ...
-
bioRxiv - Neuroscience 2024Quote: ... Four wells of EBs per line were seeded in a 4-layer cell discs coated with growth factor-reduced matrigel in X-VIVO15 medium (Lonza) supplied with GlutaMAX (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... HSPCs (2×105 cells/condition) were transfected with RNP complexes using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza) and the CA137 program (Nucleofector 4D ...
-
bioRxiv - Cell Biology 2023Quote: ... 2005) using Amaxa Basic Parasite Nucleofector Solution 1 using the X-001 program of an Amaxa Nucleofector II (Lonza, Switzerland). Clones were selected by growth in medium containing phleomycin (2.5 μg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... the medium was removed and replaced by Ultradoma Protein-Free (LONZA). The cultured medium was harvested and replenished on the second ...
-
bioRxiv - Genetics 2022Quote: ... membranes were stained with SYPRO-Ruby Protein Gel Stain (Lonza Rockland) to confirm equal loading ...