Labshake search
Citations for Lonza :
651 - 700 of 2285 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... from Lonza were cultured in T-75 cell culture flasks in Endothelial Cell Growth Medium-2 (EGM-2) (BulletKit, Lonza, Cat. No. CC-3162). EGM2 was made from Endothelial cell Basal Medium – 2 (EBM2) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... human aortic endothelial cells (CD31+) from were maintained in EGM™-2 Endothelial Cell Growth Medium-2 Bullet Kit™ (Cat # CC-3162; Lonza) and EGM™ −2 MV Microvascular Endothelial Cell Growth Medium-2 Bullet KitTM (Cat #CC-3202 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:200 MEM-NEAA supplemented with dual SMAD inhibitors: 2 μM Dorsomorphin (StemMACS, cat. #130-104-466) and 2 μM A-83-01 (Lonza, cat. #9094360). On day 6 ...
-
bioRxiv - Bioengineering 2023Quote: ... BOECs were generated from peripheral porcine blood as previously described.13 BOECs were maintained in endothelial growth medium-2 (EGM-2) (#CC-3162, Lonza, Portsmouth, NH) supplemented with 10% fetal bovine serum (#F08BB22A1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Biophysics 2021Quote: ... were grown in EGM-2 medium (Lonza, Basel, Switzerland). To express progerin in HUVECs ...
-
bioRxiv - Cell Biology 2020Quote: ... with complete medium EGM-2 Bulletkit (CC-3162, Lonza) supplemented with 0.01% Penicillin/Streptomycin (#15140122 ...
-
bioRxiv - Microbiology 2019Quote: ... HVMEC cells were grown in EGM MV-2 (Lonza) media at 37 °C in 5% CO2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Amplicons were then purified using a 2% agarose (Lonza) gel and the QIAquick Gel Extraction Kit (QIAGEN) ...
-
bioRxiv - Biochemistry 2020Quote: ... pooled from multiple donors were purchased from Lonza and maintained in EGM-2 supplemented growth media (Lonza). All cells were maintained in a 5% CO2 incubator at 37 °C.
-
bioRxiv - Bioengineering 2021Quote: ... were cultured in Endothelial Growth Medium 2 (EGM2) (Lonza) supplemented with plasmocin prophylactic (Invivogen ...
-
bioRxiv - Bioengineering 2020Quote: ... HUVECs were cultured in EBM-2 (Lonza, Walkersville, MD) containing supplements from the EGM-2 kit ...
-
bioRxiv - Bioengineering 2021Quote: ... supplemented with FBS and an EGM-2 BulletKit (Lonza) optimized for HUVEC culture ...
-
bioRxiv - Bioengineering 2020Quote: ... were purchased from Lonza and were cultured in EGM-2 media (Lonza, Switzerland). MDA-MB-231 breast cancer cells were purchased from ATCC and cultured in DMEM (low glucose ...
-
bioRxiv - Cell Biology 2021Quote: ... and cultured in EGM-2 medium (Lonza, CC-3162). All cell lines were genotyped to confirm their identity at Genewiz ...
-
bioRxiv - Cancer Biology 2020Quote: ... were cultured in EGM-2 medium (Lonza, Wokingham, UK).
-
bioRxiv - Cell Biology 2021Quote: ... CD31+ endothelial cells were expanded in EGM-2 (Lonza) in Matrigel flasks and cryopreserved.
-
bioRxiv - Biophysics 2020Quote: ... we added buffer (2 μL 10x MOPS buffer, Lonza) and loading dye (8 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... ascorbic acid and heparin (EGM-2 SingleQuots Supplements, Lonza). Cells were grown in T-75 flasks ...
-
bioRxiv - Cell Biology 2020Quote: ... iPSCs were resuspended in nucleofection solution 2 (Amaxa; Lonza) with 10 μg of donor plasmid and 3 μg of ZFN messenger RNA per 2 × 106 cells ...
-
bioRxiv - Bioengineering 2021Quote: ... Endothelial cells were cultured in EGM-2 medium (Lonza). Human mesenchymal stem cells (hMSCs ...
-
bioRxiv - Bioengineering 2022Quote: ... were cultured in Endothelial Growth Medium 2 (EGM2, Lonza). Cells were maintained at 37 °C and 5% CO2 and were used before passage 5 ...
-
bioRxiv - Biochemistry 2022Quote: ... Endothelial basal medium-2 was from Lonza (Basal, Switzerland). Fetal bovine serum (FBS) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2% foetal bovine serum and gentamicin with amphotericin (Lonza). Cells were passaged every three days ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 2 mM L-Glutamine (Lonza, Milano, Italy), penicillin (100 U/mL ...
-
bioRxiv - Cancer Biology 2020Quote: ... were grown in EGM-2 SingleQuot Kit media (Lonza) and used at passage 4-6 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1.5 × 105 treated cells in EGM-2 media (Lonza) were added to each well containing Matrigel ...
-
bioRxiv - Cell Biology 2020Quote: ... Human myoblasts were maintained in SKGM-2 medium (Lonza) and cells at passage 2-4 were used for experiments.
-
bioRxiv - Immunology 2020Quote: ... were obtained from Lonza and cultured in EGM-2 complete culture medium (Lonza). ECs were seeded at 5000 cells/cm2 and cultured to at least 70% confluence before co-culture with CD4+ T cells.
-
bioRxiv - Immunology 2021Quote: ... were cultivated in endothelial cell medium (EGM-2; Lonza) containing 2% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... in complete medium (EGM-2-MV, Lonza, Basel, Switzerland) consisting of basal medium (EBM-2 ...
-
bioRxiv - Cell Biology 2020Quote: ... were grown in EGM-2 MV culture medium (Lonza). HDMVECs were not used after 8 passages ...
-
Reprogramming enriches for somatic cell clones with small scale mutations in cancer-associated genesbioRxiv - Genomics 2020Quote: ... The ECs were cultured in EGM-2 medium (Lonza) for 4-5 passages ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 2 mM L-Glutamine (Lonza, Milano, Italy), 100 units/mL penicillinstreptomycin mixture (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... USA) and were maintained in FGM-2 BulletKit (Lonza) and KGM-Gold BulletKit (Lonza ...
-
bioRxiv - Immunology 2021Quote: ... were cultured using endothelial growth media (EGM-2; Lonza). To passage cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were grown in 15 mL EBM-2 (Lonza) supplemented with EGM-2 MV SingleQuot Kit (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 2 mM L-Glutamine (Lonza, Milan, Italy), 100 units/mL penicillin-streptomycin mixture (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 2 mM L-Glutamine (Lonza, Milano, Italy), penicillin (100 U/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2% L-Glutamine (cat#BE17-605E from Lonza) at 5% CO2 and 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... EMB-2 cell culture media was purchased from Lonza. Phosphate buffered saline (PBS) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and gentamicin/amphotericin B (FGM-2; singlequots; Clonetics/Lonza). At 80% confluency ...
-
bioRxiv - Microbiology 2022Quote: ... were obtained from Lonza and cultured with the EGM-2-MV medium (Lonza). To prepare the airway-on-a-chip ...
-
bioRxiv - Cell Biology 2022Quote: ... using Endothelial Basal Medium 2 (Lonza Cat# CC-3156) supplemented with 10% FBS (Hyclone ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with the EGM-2 MV SingleQuots kit (Lonza). For culturing of primary lymphocytes ...
-
bioRxiv - Physiology 2023Quote: ... and growth factors (EGM-2 SingleQuot; Lonza, Basel, Switzerland). Cells were used at passage 2-5 and plated onto 8 well chamber slides (Ibidi ...
-
bioRxiv - Neuroscience 2023Quote: ... and further diluted into culture media (EBM-2 (Lonza) with 1% FBS and no growth factors ...
-
bioRxiv - Developmental Biology 2023Quote: HUVECs (ATCC) were grown in EBM-2 media (Lonza) supplemented with EGM-2 SingleQuots (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: ... were cultured in EGM-2 (Lonza, Allendale, NJ, USA) and only used between passage 1–4 ...