Labshake search
Citations for Lonza :
451 - 500 of 2285 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 2.5 × 10 5 phNPCs cells were used per electroporation reaction in one cuvette of the 16-well Nucleocuvette Stripe (Lonza). After trypsinization ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)– 2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Bioengineering 2022Quote: ... Endothelial Cell Growth Basal Medium-2 (EBM) and EGM-2 SingleQuots™ Supplements were obtained from Lonza. Fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2022Quote: ... and 2*105 HUVECs in a volume of 200 μl EGM-2 medium (Lonza Group Ltd, Switzerland) were seeded and cultivated overnight under static conditions ...
-
bioRxiv - Bioengineering 2022Quote: ... termed assay medium (EBM-2 medium containing hFGF, hydrocortisone, GA-1000, 2% FBS, all from Lonza Biosciences). Cells were allowed to settle for 2 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... The hCMEC/D3 cells were cultured in EBM-2 medium supplemented with EGM-2 MV SingleQuots (Lonza) on plates coated with rat tail collagen I (20 µg/cm2 ...
-
bioRxiv - Bioengineering 2021Quote: ... in EGM-2 MV Microvascular Endothelial Cell Growth Medium containing EBM-2 basal medium (Lonza cat. CC3156) and supplemented with penicillin (50 units/mL ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human umbilical vein endothelial cells (HUVEC) were grown in endothelial cells growth medium-2 (EGM-2) (Lonza). All cells were cultured at 37◻°C and 5% CO2 in incubator cells.
-
bioRxiv - Synthetic Biology 2022Quote: ... and EGM™ −2 MV Microvascular Endothelial Cell Growth Medium-2 Bullet KitTM (Cat #CC-3202; Lonza) in collagen coated culture dishes (Cat # 08-772-75 ...
-
bioRxiv - Immunology 2022Quote: ... 24 and 48 well-plates in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (LONZA) supplemented with GlutaMax (ThermoFisher ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... MilliporeSigma) plates with a density of 20,000 cells/cm2 with Endothelial Growth Medium-2 (EGM-2; Lonza), which consists of Endothelial Growth Basal Medium-2 (EBM-2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were cultured in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, CC-3162) and plated in T75 culture flask at 5000 cells/ cm2 with iMatrix-511 (Nacalai USA #892021).
-
bioRxiv - Cell Biology 2024Quote: ... were cultured on fibronectin-coated plates in EBM-2 Basal Medium with EGM-2 MV supplements (Lonza) and 10 ug/mL VEGF-C (RnD Systems) ...
-
bioRxiv - Microbiology 2021Quote: ... and 10^6 cells were transfected into cells using Amaxa 96-well Nucleofector (Lonza, Basel, Switzerland) SF kit on program DS-138 ...
-
Single-cell analysis of skeletal muscle macrophages reveals age-associated functional subpopulationsbioRxiv - Cell Biology 2022Quote: ... 6 × 106 macrophages were resuspended in 200 μL of Hams F10 complete media (Lonza, 12-618F) containing 10% horse serum (Gibco ...
-
bioRxiv - Immunology 2020Quote: ... Lymph nodes were embedded in 6 % w/v low melting point agarose (Lonza, Walkersville MD, USA) in 1X PBS ...
-
bioRxiv - Immunology 2021Quote: ... washed in PBS by centrifugation for 5 min at 1300 rpm at 4°C and resuspended at 4.0 × 106 cells/ml in complete medium (IMDM 2 mM glutamax I supplemented with 8% heat-inactivated FCS (Lonza), 2% heat-inactivated chicken serum ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Microbiology 2023Quote: ... plates were incubated at 37°C for 30 minutes in blocking buffer (PBS with 1% BSA, 5% FBS, and 1% human AB serum (Lonza, Walkersville, MD, USA), washed three times in PBS with 0.05% tween 20 and incubated with a commercial anti-SARS-CoV-2 Spike antibody (1/1000 ...
-
bioRxiv - Immunology 2022Quote: ... 2×106 B cells were then nucleofected with 2 μg of plasmid DNA using Nucleofector Kit V (Lonza) and rested for at least 16-24 hours using complete media containing 5 ng/ml BAFF and lacking LPS ...
-
bioRxiv - Developmental Biology 2022Quote: Primary human umbilical vein endothelial cells (HUVECs, passage 2) were thawed and cultured in EGM-2 media (Lonza). Media was replaced every 48h ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with 6.6 % FCS and 33 % EBM™-2 Endothelial Cell Growth Basal Medium-2 (Lonza, Basel, Switzerland). HELA cells (DSMZ ACC-57 ...
-
bioRxiv - Neuroscience 2020Quote: ... HUVECs were cultured in endothelial basal medium (EBM-2) supplemented with endothelial growth factors EGM-2 SingleQuots (Lonza).
-
bioRxiv - Neuroscience 2021Quote: ... coated coverslips in a 24-well plate in 1ml Endothelial Growth Media-2 Bullet Kit (EGM-2; Lonza; Endothelial basal media-2 with 2% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Neuroscience 2022Quote: ... were cultured in EGM-2 endothelial cell growth medium-2 from the BulletKit (Lonza, Basel, Switzerland; CC-3162). Pericytes and astrocytes were used for experiments up to passage 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... Human umbilical vein endothelial cells (HUVECs) were cultured in EBM-2 medium supplemented with EGM-2 SingleQuots (Lonza) on plates coated with rat tail collagen I (20 µg/cm2 ...
-
bioRxiv - Bioengineering 2019Quote: ... HUVECs P6 were cultured on flask in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit ™ (Lonza). Cells were detached and loaded in PLA devices with seeding density 1 ×106 cells/ml ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2×106 iPSC single cells were transfected using the Amaxa Human Stem Cell Nucleofector® Kit 2 (Lonza) with 4 μg ...
-
bioRxiv - Cell Biology 2022Quote: ... cat# 540-05a) were cultured in flasks coated with 2% gelatin using endothelial basal medium 2 (EBM2, Lonza) supplemented with bullet kit additives plus 10% fetal bovine serum ...
-
bioRxiv - Pathology 2023Quote: ... and the cell pellet was resuspended in 10 mL of Endothelial Cell Growth Medium-2 (EGM-2, Lonza). The cell suspension was plated into a 75 cm2 tissue culture treated flask and cultured in a 5% CO2 incubator at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were cultured in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit (Lonza cat. no. CC-3162) in sterile conditions within a 5% CO2 and 37°C incubator ...
-
bioRxiv - Molecular Biology 2023Quote: ... The culture medium used was EGMTM-2 MV Microvascular Endothelial Cell Growth Medium-2 BulletKitTM (Lonza, Basel, Switzerland). The cells were cultured for 24 h and total RNA was collected as described in the RT-PCR protocol.
-
bioRxiv - Molecular Biology 2024Quote: ... were added to ABCs and EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, CC-3162) with iMatrix was added to HUVECs and then incubated in 37°C at 5% O2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Three slices were placed in one well of a 12-well plate and incubated with 2 mL DMEM (Lonza, #42430) with 0.6% amphotericin B ...
-
bioRxiv - Cancer Biology 2024Quote: ... by flushing one femur with PBS 2% FBS followed by erythrocyte elimination with ACK Lysing Buffer (10-548E, BioWhittaker, Lonza) (Figure 4BC) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 days after nucleofection with the AMAXA Nucleofector Kit (Lonza), we applied puromycin selection until we observed the appearance of green colonies ...
-
bioRxiv - Developmental Biology 2020Quote: ... embedded in 4% low melting temperature agarose (Lonza, Cat # 50100) and sectioned in a vibratome to produce 300μm-thick coronal slices ...
-
bioRxiv - Microbiology 2019Quote: ... a solution of 4% (wt/vol) SeaPlaque GTG agarose (Lonza) in MilliQ water was sterilized for 30 minutes at 250°C ...
-
bioRxiv - Bioengineering 2023Quote: ... Normal human dermal fibroblasts (NHDFs; Lonza; passages 4 to 10) were cultured on dishes in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Neuroscience 2024Quote: ... and mounted in 4% low melting point agarose (50100, Lonza) for sectioning (70 μm ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 2 mM Ultraglutamine I (Lonza), 10 mM HEPES (GIBCO) ...
-
bioRxiv - Molecular Biology 2022Quote: ... were cultured in EGM-2 medium (Lonza) at 37 °C in a 5% CO2 incubator ...
-
bioRxiv - Genomics 2020Quote: ... run on a 2% NuSieve agarose (Lonza) gel ...
-
bioRxiv - Cancer Biology 2019Quote: ... were cultured with EGM-2 medium (Lonza), and maintained at 37°C with 5% CO2 ...
-
bioRxiv - Bioengineering 2021Quote: ... were obtained from Lonza and cultured in EBM-2 medium (Lonza) supplemented with penicillin-streptomycin (Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... and EGM-2 SingleQuot bullet kit (Lonza). For imaging experiments ...
-
bioRxiv - Immunology 2019Quote: ... 2 mM ultraglutamine (Lonza, #BE17-605E/U1), 25 mM HEPES (Gibco ...
-
bioRxiv - Immunology 2019Quote: ... 2 mM L-glutamine (Lonza, #17-605E), 12.5% Fetal Bovine Serum (Gibco ...