Labshake search
Citations for Lonza :
6601 - 6650 of 9615 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Pelleted cells were resuspended in 100 μL of complete P3 Primary Cell Solution (Lonza #V4XP-3024), then mixed with the RNP/ssODN by trituration ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.25mM L-Glutamine (Lonza, 17-605E). Cells were then counted and platted at a density of 15,000 cells/coverslip in a 24-well plate for immunostaining analysis ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 µg mRNA was transfected into 0.5× 106 fibroblasts using Cell Line Nucleofector Kit V (Lonza) and AMAXA program X-001 following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Cells were transfected using the SF Cell Line 4D-Nucleofector™ X kit (Lonza) with the 4D Nucleofector X unit ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with 10% fetal bovine serum (FBS; Lonza), 1% GlutaMAX (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... then subcloned into pmaxCloning™ vector (Lonza). Prior to EO injection ...
-
bioRxiv - Cell Biology 2021Quote: ... using the MycoAlert™ Mycoplasma Detection Kit (Lonza, Switzerland), as per manufacturer’s instructions.
-
bioRxiv - Genomics 2021Quote: ... with 10% fetal bovine serum (Lonza), 4% Glutamax (Gibco) ...
-
bioRxiv - Genomics 2021Quote: ... Human chronic myeloid leukemia HAP1 cells (Horizon™ C859) were cultivated in Iscove’s Modified Dulbecco’s Medium (IMDM) with 20% fetal bovine serum (Lonza) and 1% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Genomics 2021Quote: ... The cells were cultured in McCoy’s 5A medium (ATCC) with 10% fetal bovine serum (Lonza), 2 mM L-glutamine (ATCC) ...
-
bioRxiv - Genomics 2021Quote: ... with 10% fetal bovine serum (Lonza), and 1% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Genetics 2021Quote: ... using an Amaxa 4D-Nucleofector (Lonza). Synthetic sgRNA (Synthego ...
-
bioRxiv - Genetics 2021Quote: Parallel nucleofections of Cas9 RNP and ssODN in KOLF2.1J cells were carried out in P3 Primary Cell buffer in 16-well cuvettes (Lonza) using an Amaxa 4D-Nucleofector (Lonza) ...
-
bioRxiv - Biophysics 2021Quote: ... were purchased from Sigma Aldrich and cultured in high glucose Dulbecco’s modified Eagle’s medium (DMEM; Lonza BE12-614F), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biophysics 2021Quote: ... and penicillin/streptomycin (Lonza 17-602E). Cell cultures were maintained at 37°C within a humidified TEB-1000 incubator (EBERS Medical Technology ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mM L-glutamine (Lonza 17-605C) and penicillin/streptomycin (Lonza 17-602E) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were routinely tested for mycoplasma infection using MycoAlert™ Mycoplasma Detection Kit (Lonza). Cells were not contaminated with mycoplasma.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Dry powder (2-3 mg) was loaded into an HPMC size 3 capsule (VCaps® Plus, Lonza, Morristown, NJ). The capsule was placed in a Plastiape high resistance RS00 DPI that was then attached to a Next Generation Impactor (NGI ...
-
bioRxiv - Physiology 2021Quote: Sinonasal epithelial cells were enzymatically dissociated and grown to confluence in proliferation medium (50% DMEM/Ham’s F-12 plus 50% BEBM plus Lonza Singlequot supplements) for 7 days (18–20 ...
-
bioRxiv - Physiology 2021Quote: ... H441 ALIs were switched to bronchial epithelial cell basal media (BEBM; Lonza, Walkersville MD) plus Lonza Singlequot supplements (differentiation media ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Nucleofection with the Cas9 RNP was conducted using a 4D-Nucleofector (Lonza) according to the manufacturer's protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... as determined by using MycoAlert (Lonza: LT07-118) and a Mycoplasma PCR Detection Kit (Beyotime Biotechnology ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human (HSMMs) and canine skeletal muscle myoblasts (CnSkMCs) were purchased from Lonza (Walkersville, MD) and Cell Applications ...
-
bioRxiv - Cancer Biology 2021Quote: ... HSMMs and CnSkMCs were cultured in SkGM-2 (CC-3245, Lonza) and CnSkMC growth medium (Cn151-500 ...
-
bioRxiv - Cancer Biology 2021Quote: ... They were routinely tested for mycoplasma using a luminescence-based mycoplasma detection kit (MycoAlert Mycoplasma Detection kit, Lonza #: LT07-318).
-
bioRxiv - Cancer Biology 2021Quote: ... Ker-CT cells were maintained in KGM-Gold Keratinocyte growth medium supplemented with KGM-Gold™ BulletKit™(Lonza #00192060). Cells were split when confluent ...
-
bioRxiv - Cancer Biology 2021Quote: ... Monocytes were seeded onto dentine discs (elephant dentine; HM Revenue & Customs, Heathrow Airport, UK) or plastic dishes in α-MEM (without ribonucleosides/ deoxyribonucleosides; Lonza) containing 10% heat-inactivated FBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... fixed after 12 days and stained according to the OsteoImage™ Mineralisation Assay Lonza kit (PA-1503, Lonza) protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... or Human Mesenchymal Stem Cell (hMSC) Osteogenic Differentiation Medium BulletKitTM (PT-3002, Lonza) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... MSC used as control were passaged and maintained in MSCGM Mesenchymal Stem Cell Growth Medium BulletKitTM (PT-3001, Lonza). All steps were performed at 37°C.
-
bioRxiv - Bioengineering 2021Quote: ... using the P3 Primary Cell 4D-Nucleofector Kit (Lonza) and the EO-100 program51,52 ...
-
Empowering Engineered Muscle Function by Extending Connexin 43 Duration with Reduced Graphene OxidesbioRxiv - Bioengineering 2021Quote: ... supplemented with 10% (vol/vol) fetal bovine serum (FBS, Lonza), 1% (vol/vol ...
-
bioRxiv - Bioengineering 2021Quote: H1 hESCs were targeted via nucleofection using an Amaxa-4D (Lonza) as described previously11 ...
-
bioRxiv - Bioengineering 2021Quote: ... hepatic endoderm cells were incubated in HCM Bulletkit (Lonza) differentiation media supplemented with 30 ng/ml Oncostatin M (Miltenyi Biotec ...
-
bioRxiv - Bioengineering 2021Quote: pMAX-GFP (Lonza) was digested with KpnI and SacI ...
-
bioRxiv - Pathology 2021Quote: ... Models were cultured in EGM-2 (Lonza) at 37°C and 5% CO2 for 48 h to ensure confluence ...
-
bioRxiv - Pathology 2021Quote: ... 2 mM glutamine (Lonza), and 100 U/ml Penicillin-Streptomycin (PS ...
-
bioRxiv - Pathology 2021Quote: ... and 100 U/ml Penicillin-Streptomycin (PS) (Lonza). Experiments were performed in passage 2 ...
-
bioRxiv - Pathology 2021Quote: ... the wires were removed and the through-channels were filled with tissue culture media (1:1 mixture of X-Vivo15 and Bronchial Epithelial Growth media (Lonza, USA) with antibiotics (MP Biomedicals ...
-
bioRxiv - Neuroscience 2021Quote: ... An Amaxa Nucleofector 2b Device and a Mouse Embryonic Fibroblast Nucleofector Kit 1 (Lonza) were used to transfect MEFs with βCTF-3xFLAG plasmid using program N-024 of the Nucleofector (Supplementary Figure 3).
-
bioRxiv - Biophysics 2021Quote: ... 2 μg of each Pcdh expression construct were transfected into 20 μL of the K562 cell suspension by electroporation using an Amaxa 4D- Nucleofector (Lonza). Transfected cells were transferred to a 24-well plate in 500 μL of medium per well and incubated overnight at 37°C and 5% CO2 ...
-
bioRxiv - Biophysics 2021Quote: ... and resuspended at a density of ∼1.5x104 cells/μL in SF Cell Line 4D-Nucleofector Solution SF with supplement according to manufacturer instructions (Lonza). 2 μg of each Pcdh expression construct were transfected into 20 μL of the K562 cell suspension by electroporation using an Amaxa 4D- Nucleofector (Lonza) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Dulbecco’s Modified Eagle Medium (DMEM) and RPMI 1640 were purchased from Lonza. FluoForte™ Kit was purchased from Enzo Life Sciences ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Primary human lung microvascular endothelial cells (hLMVECs) from Lonza were cultured in EBM-2 supplemented with 10% endotoxin-free fetal bovine serum (Omega Scientific) ...
-
bioRxiv - Biophysics 2021Quote: ... using the Nucleofactor 2b Device (Lonza).
-
bioRxiv - Biophysics 2021Quote: ... Primary human lung microvascular endothelial cells (HMVEC) were purchased from Lonza,cultured using Vascular Cell Basal Medium (ATCC® PCS-100-030) ...
-
bioRxiv - Genomics 2021Quote: ... and 0.5% UltraGlutamin (Lonza). Hap1 SA1 and SA2 knock-out cells were generated using gRNA’s targeting SA1 exon 2 (ACTACTGCCCATTCCGATGC ...
-
bioRxiv - Genomics 2021Quote: ... and pMaxGFP plasmid at 200ng/ul (Lonza) using solution P3 and program CA-137.
-
bioRxiv - Immunology 2021Quote: ... the bacteria were resuspended in 380 μl X-VIVO 15 cell culture medium (Lonza, the Netherlands) with 50 μg/ml gentamycin (Gibco™ ...
-
bioRxiv - Developmental Biology 2021Quote: Human iPSCs were generated using the electroporation (4D-Nucleofector System, Lonza) of fibroblasts with episomal vectors ...