Labshake search
Citations for Lonza :
601 - 650 of 743 citations for Locostatin CAS 90719 30 5 100% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: BHK-21 cells (clone BSRT7/5) constitutively expressing the T7 RNA polymerase47 were grown in Dulbeco Modified Essential Medium (Lonza) supplemented with 10% fetal calf serum (FCS) ...
-
bioRxiv - Cell Biology 2023Quote: HEK293T cells were grown in fifteen 25 cm2 flasks at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were used at passages 3-5 for experiments and cultured at 37°C and 5% CO2 in complete EC basal medium containing growth factors EGM2-Bulletkit (Lonza) to ensure a stable environment for optimal cell growth ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-6 million primary human keratinocytes were electroporated with 1 nmol siPools using the Amaxa human keratinocyte Nucleofector kit (Lonza) according to the manufacturer’s instructions and the T-018 program of the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cells were maintained at 37°C and 5% CO2 and 95% relative humidity and regularly tested negative for mycoplasma infection by Mycoalert detection kit (Lonza). For 3D growth conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... Two million of MNCs were transfected with 10 μg of plasmid (5:1 ratio pEB-C5:pEBTg) as instructed by the Lonza CD34+ nucleofector kit (VPA-1003, Lonza) and Amaxa nucleofector (program T-016 ...
-
bioRxiv - Cell Biology 2024Quote: ... Two million E14 ESCs were nucleofected with paired Kdm3b targeting and donor plasmids (5 µg each) using the Amaxa 4D-Nucleofector protocol (Lonza) and selected with blasticidin S hydrochloride (Research Products International ...
-
bioRxiv - Cell Biology 2024Quote: ... serum-starved RPE1 cells where trypsinized and 0.5×106 of the cells were resuspended in 20 μl of the P3 Primary Cell 4D-Nucleofector Kit buffer (Lonza). The cell suspension was then nucleoporated with reporter plasmids with DNA lesions and undamaged control plasmids ...
-
bioRxiv - Bioengineering 2023Quote: ... Both cell lines were maintained in an incubator at 37 °C and 5% CO2 and tested for Mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza) regularly.
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were maintained at 37°C in 5% CO2 and frequently examined for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2023Quote: NIH/3T3 fibroblasts were cultured at 37 °C and 5% CO2 in low-glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Lonza, Basel, Switzerland) and 1% penicillin/streptomycin antibiotic ...
-
bioRxiv - Microbiology 2022Quote: ... Both HPMEC and HUVEC cell lines were propagated (passages 5–10) and maintained in endothelial growth medium 2 (EGM-2) using the EGM-2 bullet kit from Lonza following the manufacturer’s specifications and grown in a CO2 incubator at 37°C with 5% CO2.
-
bioRxiv - Immunology 2022Quote: ... Cryopreserved PBMC (5 x 106/sample) were thawed in prewarmed RPMI-1640 media supplemented with L-glutamine (Lonza, Basel, Switzerland) + 10% FCS ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary MEC were cultured in endothelial growth media (EGM) containing 5% FBS with growth factors (EBM-2; Lonza, Basel, Switzerland) at 37°C in 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... prepared in tris-acetate (40 mM)/EDTA (10 mM) buffer and 5 μl of GelStar Nucleic Acid Stain 10,000 x (Lonza, 50535). 20 μl per sample resulting from PCR were mixed with Blue/Orange loading buffer loading dye 6x (PROMEGA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were maintained at 37 °C in a humidified atmosphere containing 5% carbon dioxide (CO2) and were tested for mycoplasma contamination using MycoAlert Mycoplasma detection kit (Lonza).
-
bioRxiv - Molecular Biology 2024Quote: All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza). Human primary hepatic stellate cells used for the main experiments were from Lonza (HUCLS ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 and tested negative for mycoplasma contamination by MycoAlert mycoplasma detection kit (Lonza). Expression of doxycycline-inducible shRNA was induced by supplementing media with 0.1-1 µg/ml doxycycline for 6 days ...
-
bioRxiv - Pathology 2024Quote: Primary human lung fibroblasts from either IPF patients (n=4) or donors with no history of lung fibrosis (n=5) were purchased from Lonza at P2 (Supplementary Table 6) ...
-
bioRxiv - Cell Biology 2024Quote: ... cells (5×105/well in 6-well plates) were transfected with 2 μg of DNA by nucleofection using Amaxa device (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were grown at 37°C in a humidified incubator with 5% CO2 and were regularly performed mycoplasma test using a MycoAlert Mycoplasma Detection kit (Lonza). Cells with mycoplasma-free were used for experiments.
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were maintained at 37 °C in a 5% CO2 humidified atmosphere and regularly screened for the presence of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza). Cell lines were cultured for no more than 20 passages following thawing ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were seeded on the fibronectin-coated Petri dish (TPP) and kept in the incubator (37 °C and 5% CO2) for 4-8 h in the EGM-2 (Lonza) containing 2% FBS ...
-
bioRxiv - Biochemistry 2024Quote: ... All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza).
-
bioRxiv - Genetics 2024Quote: ... Cells were cultured at 37°C in a humidified atmosphere and 5% CO2 in a 1:1 mixture of DMEM (Lonza) and Ham’s F10 (Lonza ...
-
bioRxiv - Molecular Biology 2023Quote: ... MCF-10A human mammary gland cells were used as the non-tumorigenic control and were cultured in MEBM basal medium supplemented with components included in the MEGMTM Mammary Epithelial Cell Growth Medium SingleQuotsTM Kit (Lonza, Hayward, CA). A549 human lung carcinoma cells were cultured in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Immunology 2022Quote: ... in 100 μl PBS (GE Lifesciences, Marlborough, MA) and were transfected by electroporation using a 4D-Nucleofector System (Lonza, Walkersville, MD) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... 100 ng/mL and 0.5 µg/mL or 1 µg/mL were used in Mammary Epithelial Growth Medium (Lonza, CC-3150), respectively ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Then the supernatant was removed and cells were resuspended in 100 µl room-temperature Nucleofector® Kit V (Lonza, VCA-1003) solution ...
-
bioRxiv - Cell Biology 2024Quote: ... and 95% humidity in Human IntestiCult™ Organoid Growth Medium Human (IntestiCult OGMh) supplemented with 100 U/mL penicillin/streptomycin (Pen-Strep) (Lonza). Medium was replenished every second day ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNPs were formed by combining 0.7μl of each of the three sgRNAs (100 μM in Tris-EDTA, Synthego, custom) in 6μl of SF buffer (Lonza, V4XC-2032) with 1μl recombinant Cas9 2NLS Nuclease (20 μM ...
-
bioRxiv - Cell Biology 2024Quote: ... The reagents were mixed with 1 million cells resuspended in 100 μl human stem cell buffer kit 2 (Lonza, VCA-1005); the cells were electroporated using the Amaxa nucleofector IIb program B-016 ...
-
bioRxiv - Cell Biology 2021Quote: Cell lines were cultured according to standard aseptic mammalian tissue culture protocols in 5% CO2 at 37 °C with regular testing for mycoplasma contamination using the MycoAlert™ Mycoplasma Detection Kit (Lonza). HCT 116 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were maintained at 37°C in 5% CO2 in either EGM-2 MV complete media (CC-3125, Lonza, Walkersville, MD) or in M199 supplemented with 20% FBS (Atlanta Biologicals ...
-
bioRxiv - Molecular Biology 2022Quote: HeLa cervical carcinoma cells were grown under a humidified 5% CO2 atmosphere at 37°C in Dulbecco’s modified Eagle’s medium (DMEM, Lonza, Alpharetta, GA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: Primary human lung microvascular endothelial cells (HMVEC-L) were seeded at 5000 cells/cm2 in EBM-2 with 5% FBS and EGM-2 supplement (all products, Lonza Bioscience) until reaching complete confluence 14 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and immortalized human Brain Microvascular Endothelial cells (HBMEC) were seeded at 5000 cells/cm2 in EBM supplemented with 5% FBS and EGM supplements (all products, Lonza Bioscience) until reaching confluence 42,43 ...
-
bioRxiv - Neuroscience 2022Quote: ... cellular ATP content was measured two-three times a week between 5-7.5 weeks post transduction using the ViaLight Plus kit (Lonza, LT07-221) or ATPlite kit (PerkinElmer ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RBD-Fc stable clone was obtained by electroporation with 2×106 cells and 5 μg endotoxin-free plasmids using Amaxa kit V and program U24 with Amaxa Nucleofector 2B (Lonza, Switzerland). Electroporated cells were subsequently plated in 96-wells at 500 cells/well in Plating Medium containing 80% EX CELL® CHO Cloning Medium (Cat.no C6366 ...
-
bioRxiv - Molecular Biology 2022Quote: ... collected by centrifugation at 500xg for 5 min and resuspended in SF solution (SF cell line 4D-Nucleofector™ X Kit, Lonza). After addition of the RNP ...
-
bioRxiv - Biophysics 2023Quote: ... 1.5mL for a T75 flask for 5 minutes at 37° C and resuspended in 80 μL of SF cell line solution (Lonza; Basel) per flask ...
-
bioRxiv - Physiology 2022Quote: ... 1 million cells were washed with PBS and electroporated with 5-10 μg of appropriate plasmid using Amaxa cell nucleofector kit T (Lonza laboratories). Cells were allowed to recover for 48 h ...
-
Optimisation of immunocytochemistry methodology for the detection of endogenous eIF2B localised focibioRxiv - Cell Biology 2022Quote: ... Cells were maintained at 37ºC under 5% CO2 in a humidified atmosphere and routinely tested for contamination with MycoAlter™ Mycoplasma Detection Kit (Lonza, UK). Cells were validated through lineage-specific markers - anti-GFAP antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were maintained at 37°C under 5% CO2 and were routinely tested for contamination with MycoAlert™ Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Immunology 2023Quote: ... Md) and cultured overnight at 37C culture at 378C with 5% CO2 in serum free HL-1 media (Lonza, Walkersville, Md) supplemented with Pen-Strep and 8 mmol/L Glutamax (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... All cells were maintained at 37°C in a 5% CO2 humidified atmosphere and were regularly screened for the presence of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, Switzerland).
-
Loss of TMEM55B modulates lipid metabolism through dysregulated lipophagy and mitochondrial functionbioRxiv - Cell Biology 2024Quote: ... Cells were transfected with 5 μg negative control or Jip4-Cas9/sgRNA complex using Cell Line Nucleofector™ Kit T (VCA-1002, Lonza) with Amaxa Biosystems Nucleofector II ...
-
bioRxiv - Bioengineering 2024Quote: ... were maintained in culture at 37°C and 5% CO2 atmosphere and using a growth media comprising Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Physiology 2021Quote: ... were mixed with 1.49 μL of ssODN (100 μM) and Cas9 complex consisting of 18 μL SF 4D-nucleofector X solution + supplement1 (Lonza V4XC-2012), 6 μL of sgRNA (30 pmol/μL) ...